Incidental Mutation 'R4355:Casz1'
ID 371120
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Name castor zinc finger 1
Synonyms D4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 041108-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4355 (G1)
Quality Score 22
Status Validated
Chromosome 4
Chromosomal Location 148804429-148954889 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148952335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1685 (S1685P)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122222]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000122222
AA Change: S1685P
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: S1685P

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123548
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 (GRCm38) Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 (GRCm38) F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 (GRCm38) V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 (GRCm38) F173L probably null Het
Arntl A G 7: 113,303,406 (GRCm38) I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 (GRCm38) C208* probably null Het
Cep250 A G 2: 155,991,525 (GRCm38) E1789G probably damaging Het
Cep76 A T 18: 67,626,640 (GRCm38) D334E probably benign Het
Clca3b A T 3: 144,825,458 (GRCm38) probably null Het
Col9a3 A G 2: 180,606,478 (GRCm38) S208G probably benign Het
Ddx47 T C 6: 135,021,505 (GRCm38) V388A probably benign Het
Dync1h1 C T 12: 110,632,899 (GRCm38) A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 (GRCm38) R411S probably benign Het
F7 A G 8: 13,034,774 (GRCm38) T267A probably benign Het
Fras1 C A 5: 96,700,242 (GRCm38) D1770E probably benign Het
G2e3 T A 12: 51,365,337 (GRCm38) Y387N probably benign Het
Hspg2 C T 4: 137,529,418 (GRCm38) L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 (GRCm38) I110M probably benign Het
Itgb5 T A 16: 33,844,997 (GRCm38) C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 (GRCm38) N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 (GRCm38) S80P possibly damaging Het
Kif21a C T 15: 90,970,833 (GRCm38) C721Y probably benign Het
Kirrel C T 3: 87,089,151 (GRCm38) M380I probably null Het
Klrc3 T C 6: 129,639,162 (GRCm38) M189V probably benign Het
Macf1 T A 4: 123,475,091 (GRCm38) E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 (GRCm38) G160R possibly damaging Het
Myb A G 10: 21,152,617 (GRCm38) S116P probably damaging Het
Nf2 G A 11: 4,780,613 (GRCm38) Q513* probably null Het
Nmnat3 C T 9: 98,410,152 (GRCm38) T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 (GRCm38) V273F probably benign Het
Olfr743 T C 14: 50,533,759 (GRCm38) C116R possibly damaging Het
Patj T G 4: 98,650,454 (GRCm38) C210W possibly damaging Het
Pde3b A G 7: 114,416,287 (GRCm38) H246R probably benign Het
Pnp2 A G 14: 50,959,625 (GRCm38) H56R probably benign Het
Prkg1 A G 19: 30,569,229 (GRCm38) probably benign Het
Rhbdf1 C T 11: 32,216,236 (GRCm38) S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 (GRCm38) K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 (GRCm38) V560A probably benign Het
Rsph6a T A 7: 19,067,078 (GRCm38) probably null Het
Ryr2 T C 13: 11,649,812 (GRCm38) N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 (GRCm38) N132S probably benign Het
Ston1 T G 17: 88,637,008 (GRCm38) V614G probably damaging Het
Svep1 T A 4: 58,138,695 (GRCm38) T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 (GRCm38) I262N probably benign Het
Tmtc1 T C 6: 148,355,098 (GRCm38) probably benign Het
Tshz2 G A 2: 169,884,938 (GRCm38) E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 (GRCm38) S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 (GRCm38) E182* probably null Het
Usp43 A G 11: 67,891,464 (GRCm38) V376A probably benign Het
Utp15 A T 13: 98,259,247 (GRCm38) F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 (GRCm38) L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 (GRCm38) M18K probably benign Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148,929,371 (GRCm38) missense probably damaging 1.00
IGL02137:Casz1 APN 4 148,933,468 (GRCm38) missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148,934,619 (GRCm38) missense probably damaging 1.00
IGL02629:Casz1 APN 4 148,944,391 (GRCm38) missense probably benign 0.01
IGL02871:Casz1 APN 4 148,944,319 (GRCm38) missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148,952,302 (GRCm38) small deletion probably benign
G1Funyon:Casz1 UTSW 4 148,946,043 (GRCm38) missense probably damaging 0.98
H8562:Casz1 UTSW 4 148,933,451 (GRCm38) missense probably damaging 1.00
R0090:Casz1 UTSW 4 148,933,411 (GRCm38) missense probably benign 0.00
R0389:Casz1 UTSW 4 148,948,911 (GRCm38) missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148,948,911 (GRCm38) missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148,952,284 (GRCm38) small deletion probably benign
R0597:Casz1 UTSW 4 148,944,394 (GRCm38) missense probably benign 0.00
R1117:Casz1 UTSW 4 148,934,595 (GRCm38) missense probably damaging 1.00
R1476:Casz1 UTSW 4 148,946,171 (GRCm38) missense probably benign 0.05
R1540:Casz1 UTSW 4 148,942,900 (GRCm38) unclassified probably benign
R1610:Casz1 UTSW 4 148,929,087 (GRCm38) missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148,942,900 (GRCm38) unclassified probably benign
R1779:Casz1 UTSW 4 148,932,937 (GRCm38) missense probably benign 0.00
R1874:Casz1 UTSW 4 148,943,211 (GRCm38) missense probably damaging 0.99
R1902:Casz1 UTSW 4 148,936,195 (GRCm38) missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148,932,958 (GRCm38) missense probably damaging 1.00
R2126:Casz1 UTSW 4 148,946,064 (GRCm38) missense probably damaging 0.99
R2261:Casz1 UTSW 4 148,929,099 (GRCm38) missense probably damaging 0.96
R2262:Casz1 UTSW 4 148,929,099 (GRCm38) missense probably damaging 0.96
R3874:Casz1 UTSW 4 148,939,589 (GRCm38) intron probably benign
R4019:Casz1 UTSW 4 148,932,878 (GRCm38) missense probably benign 0.00
R4420:Casz1 UTSW 4 148,948,918 (GRCm38) missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148,933,267 (GRCm38) missense probably damaging 1.00
R4632:Casz1 UTSW 4 148,951,855 (GRCm38) missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148,938,981 (GRCm38) missense probably damaging 1.00
R4824:Casz1 UTSW 4 148,944,571 (GRCm38) missense probably damaging 1.00
R4907:Casz1 UTSW 4 148,944,541 (GRCm38) missense probably damaging 1.00
R5628:Casz1 UTSW 4 148,946,096 (GRCm38) missense probably damaging 1.00
R5736:Casz1 UTSW 4 148,929,410 (GRCm38) missense probably benign 0.00
R5929:Casz1 UTSW 4 148,938,969 (GRCm38) missense probably damaging 1.00
R5929:Casz1 UTSW 4 148,938,696 (GRCm38) missense probably damaging 1.00
R5932:Casz1 UTSW 4 148,939,113 (GRCm38) missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148,934,584 (GRCm38) missense probably damaging 1.00
R6019:Casz1 UTSW 4 148,947,038 (GRCm38) missense probably damaging 0.99
R6139:Casz1 UTSW 4 148,951,697 (GRCm38) missense probably damaging 1.00
R6223:Casz1 UTSW 4 148,933,383 (GRCm38) missense probably damaging 1.00
R6239:Casz1 UTSW 4 148,938,277 (GRCm38) missense probably damaging 1.00
R6323:Casz1 UTSW 4 148,941,704 (GRCm38) missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148,952,542 (GRCm38) missense unknown
R6454:Casz1 UTSW 4 148,951,495 (GRCm38) missense probably damaging 0.99
R6479:Casz1 UTSW 4 148,937,078 (GRCm38) missense probably damaging 1.00
R6529:Casz1 UTSW 4 148,938,189 (GRCm38) missense probably damaging 1.00
R6772:Casz1 UTSW 4 148,943,206 (GRCm38) missense probably damaging 1.00
R7000:Casz1 UTSW 4 148,929,236 (GRCm38) missense probably damaging 1.00
R7152:Casz1 UTSW 4 148,901,291 (GRCm38) start gained probably benign
R7324:Casz1 UTSW 4 148,947,033 (GRCm38) missense probably damaging 0.99
R7339:Casz1 UTSW 4 148,951,745 (GRCm38) missense probably damaging 1.00
R7388:Casz1 UTSW 4 148,952,393 (GRCm38) missense unknown
R7480:Casz1 UTSW 4 148,944,586 (GRCm38) missense probably damaging 0.99
R7719:Casz1 UTSW 4 148,944,524 (GRCm38) missense probably damaging 0.99
R7789:Casz1 UTSW 4 148,929,406 (GRCm38) missense probably benign
R7801:Casz1 UTSW 4 148,938,249 (GRCm38) missense probably damaging 0.99
R7815:Casz1 UTSW 4 148,929,305 (GRCm38) missense possibly damaging 0.89
R7818:Casz1 UTSW 4 148,946,076 (GRCm38) missense probably damaging 1.00
R7938:Casz1 UTSW 4 148,944,486 (GRCm38) missense probably benign 0.05
R8045:Casz1 UTSW 4 148,932,779 (GRCm38) missense probably damaging 1.00
R8134:Casz1 UTSW 4 148,943,035 (GRCm38) missense probably damaging 1.00
R8165:Casz1 UTSW 4 148,944,431 (GRCm38) missense probably damaging 1.00
R8301:Casz1 UTSW 4 148,946,043 (GRCm38) missense probably damaging 0.98
R8419:Casz1 UTSW 4 148,948,583 (GRCm38) missense probably benign 0.29
R9047:Casz1 UTSW 4 148,939,040 (GRCm38) missense probably damaging 1.00
R9420:Casz1 UTSW 4 148,938,863 (GRCm38) missense probably damaging 0.99
R9584:Casz1 UTSW 4 148,901,247 (GRCm38) start gained probably benign
RF001:Casz1 UTSW 4 148,952,304 (GRCm38) small deletion probably benign
RF063:Casz1 UTSW 4 148,952,304 (GRCm38) small deletion probably benign
X0018:Casz1 UTSW 4 148,939,008 (GRCm38) missense probably damaging 1.00
X0064:Casz1 UTSW 4 148,932,952 (GRCm38) missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148,944,359 (GRCm38) missense probably benign
Z1176:Casz1 UTSW 4 148,944,359 (GRCm38) missense probably benign
Z1177:Casz1 UTSW 4 148,944,359 (GRCm38) missense probably benign
Z1177:Casz1 UTSW 4 148,933,306 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTACAAGCTCAAGTGC -3'
(R):5'- CACATACAGAGCAGTTCTAGAGGG -3'

Sequencing Primer
(F):5'- TCGCAGATGGACTCGCACAAG -3'
(R):5'- AGCAGTTCTAGAGGGGGCTG -3'
Posted On 2016-02-19