Incidental Mutation 'R4355:Casz1'
ID 371120
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Name castor zinc finger 1
Synonyms D4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 041108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4355 (G1)
Quality Score 22
Status Validated
Chromosome 4
Chromosomal Location 148804429-148954889 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148952335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1685 (S1685P)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122222]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000122222
AA Change: S1685P
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: S1685P

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123548
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T G 8: 43,570,185 Q89H probably benign Het
Adgrb1 T C 15: 74,543,662 F697S probably damaging Het
Adgrl2 A T 3: 148,839,152 V769E probably damaging Het
Aldh7a1 A T 18: 56,548,494 F173L probably null Het
Arntl A G 7: 113,303,406 I421V possibly damaging Het
Bcl3 G T 7: 19,811,580 C208* probably null Het
Cep250 A G 2: 155,991,525 E1789G probably damaging Het
Cep76 A T 18: 67,626,640 D334E probably benign Het
Clca3b A T 3: 144,825,458 probably null Het
Col9a3 A G 2: 180,606,478 S208G probably benign Het
Ddx47 T C 6: 135,021,505 V388A probably benign Het
Dync1h1 C T 12: 110,632,899 A1896V possibly damaging Het
Eif2ak2 T A 17: 78,858,534 R411S probably benign Het
F7 A G 8: 13,034,774 T267A probably benign Het
Fras1 C A 5: 96,700,242 D1770E probably benign Het
G2e3 T A 12: 51,365,337 Y387N probably benign Het
Hspg2 C T 4: 137,529,418 L1491F probably damaging Het
Ighv3-4 T C 12: 114,253,640 I110M probably benign Het
Itgb5 T A 16: 33,844,997 C28S probably damaging Het
Kbtbd11 C A 8: 15,028,578 N392K probably damaging Het
Kcnmb4 A G 10: 116,473,284 S80P possibly damaging Het
Kif21a C T 15: 90,970,833 C721Y probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klrc3 T C 6: 129,639,162 M189V probably benign Het
Macf1 T A 4: 123,475,091 E394V possibly damaging Het
Mrgprb4 C T 7: 48,198,701 G160R possibly damaging Het
Myb A G 10: 21,152,617 S116P probably damaging Het
Nf2 G A 11: 4,780,613 Q513* probably null Het
Nmnat3 C T 9: 98,410,152 T150M possibly damaging Het
Olfr361 C A 2: 37,084,930 V273F probably benign Het
Olfr743 T C 14: 50,533,759 C116R possibly damaging Het
Patj T G 4: 98,650,454 C210W possibly damaging Het
Pde3b A G 7: 114,416,287 H246R probably benign Het
Pnp2 A G 14: 50,959,625 H56R probably benign Het
Prkg1 A G 19: 30,569,229 probably benign Het
Rhbdf1 C T 11: 32,216,236 S8N probably damaging Het
Rimbp3 A G 16: 17,209,692 K327E possibly damaging Het
Rnf219 A G 14: 104,479,257 V560A probably benign Het
Rsph6a T A 7: 19,067,078 probably null Het
Ryr2 T C 13: 11,649,812 N3535S probably benign Het
Ssfa2 A G 2: 79,641,998 N132S probably benign Het
Ston1 T G 17: 88,637,008 V614G probably damaging Het
Svep1 T A 4: 58,138,695 T466S possibly damaging Het
Tas2r109 A T 6: 132,980,181 I262N probably benign Het
Tmtc1 T C 6: 148,355,098 probably benign Het
Tshz2 G A 2: 169,884,938 E16K possibly damaging Het
Ufsp2 T A 8: 45,985,465 S193R possibly damaging Het
Ugt2b5 C A 5: 87,139,763 E182* probably null Het
Usp43 A G 11: 67,891,464 V376A probably benign Het
Utp15 A T 13: 98,259,247 F76I possibly damaging Het
Wdr62 A C 7: 30,242,248 L1141R probably damaging Het
Zfp418 T A 7: 7,172,162 M18K probably benign Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
G1Funyon:Casz1 UTSW 4 148946043 missense probably damaging 0.98
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
R7324:Casz1 UTSW 4 148947033 missense probably damaging 0.99
R7339:Casz1 UTSW 4 148951745 missense probably damaging 1.00
R7388:Casz1 UTSW 4 148952393 missense unknown
R7480:Casz1 UTSW 4 148944586 missense probably damaging 0.99
R7719:Casz1 UTSW 4 148944524 missense probably damaging 0.99
R7789:Casz1 UTSW 4 148929406 missense probably benign
R7801:Casz1 UTSW 4 148938249 missense probably damaging 0.99
R7815:Casz1 UTSW 4 148929305 missense possibly damaging 0.89
R7818:Casz1 UTSW 4 148946076 missense probably damaging 1.00
R7938:Casz1 UTSW 4 148944486 missense probably benign 0.05
R8045:Casz1 UTSW 4 148932779 missense probably damaging 1.00
R8134:Casz1 UTSW 4 148943035 missense probably damaging 1.00
R8165:Casz1 UTSW 4 148944431 missense probably damaging 1.00
R8301:Casz1 UTSW 4 148946043 missense probably damaging 0.98
R8419:Casz1 UTSW 4 148948583 missense probably benign 0.29
R9047:Casz1 UTSW 4 148939040 missense probably damaging 1.00
R9420:Casz1 UTSW 4 148938863 missense probably damaging 0.99
R9584:Casz1 UTSW 4 148901247 start gained probably benign
RF001:Casz1 UTSW 4 148952304 small deletion probably benign
RF063:Casz1 UTSW 4 148952304 small deletion probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Z1176:Casz1 UTSW 4 148944359 missense probably benign
Z1177:Casz1 UTSW 4 148933306 missense probably damaging 1.00
Z1177:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAGTACAAGCTCAAGTGC -3'
(R):5'- CACATACAGAGCAGTTCTAGAGGG -3'

Sequencing Primer
(F):5'- TCGCAGATGGACTCGCACAAG -3'
(R):5'- AGCAGTTCTAGAGGGGGCTG -3'
Posted On 2016-02-19