Incidental Mutation 'R4512:Akr1c20'
ID371129
Institutional Source Beutler Lab
Gene Symbol Akr1c20
Ensembl Gene ENSMUSG00000054757
Gene Namealdo-keto reductase family 1, member C20
Synonyms2610528B18Rik
MMRRC Submission 041587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4512 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location4486849-4523345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4507844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 201 (V201G)
Ref Sequence ENSEMBL: ENSMUSP00000077363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078239] [ENSMUST00000080361]
Predicted Effect probably damaging
Transcript: ENSMUST00000078239
AA Change: V201G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077363
Gene: ENSMUSG00000054757
AA Change: V201G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 98 4.7e-12 PFAM
Pfam:Aldo_ket_red 87 260 6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080361
AA Change: V228G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079232
Gene: ENSMUSG00000054757
AA Change: V228G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.8e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221564
AA Change: V200G
Meta Mutation Damage Score 0.5944 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,667 T497S probably damaging Het
Abcb4 A T 5: 8,928,573 D573V probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Alpk1 T C 3: 127,684,471 probably benign Het
Atp6v1h T C 1: 5,098,135 probably null Het
Aup1 C T 6: 83,056,387 R248* probably null Het
BC016579 C A 16: 45,633,000 A151S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chsy3 A G 18: 59,410,187 D799G probably damaging Het
Dnah6 G A 6: 73,178,416 R739W probably damaging Het
Dync2h1 A T 9: 7,085,009 C553* probably null Het
Fhl4 A G 10: 85,098,714 S68P possibly damaging Het
Gcc1 T C 6: 28,419,209 E375G probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Hspbap1 C T 16: 35,787,241 S39F probably damaging Het
Lmln G A 16: 33,088,137 R311Q probably benign Het
Ly6e T A 15: 74,957,833 V24D probably damaging Het
Magi3 T C 3: 104,089,555 T225A probably damaging Het
Mark1 C A 1: 184,907,089 R577L probably benign Het
Mlxip G T 5: 123,395,065 V46L probably benign Het
Mrpl40 T C 16: 18,872,558 D134G probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nalcn T C 14: 123,295,448 Y1300C probably damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ndst3 T C 3: 123,671,666 D219G probably damaging Het
Nfkbie C T 17: 45,556,239 S100L probably benign Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Odf2 C T 2: 29,926,097 probably null Het
Olfr1033 T C 2: 86,041,569 S85P probably damaging Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr733 C A 14: 50,298,996 L104F probably damaging Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Otud7a T C 7: 63,729,877 F284L probably benign Het
Parg T C 14: 32,262,736 V241A probably damaging Het
Pla2g4a T A 1: 149,861,051 probably null Het
Psd4 C T 2: 24,402,889 R684C probably damaging Het
Pttg1ip T C 10: 77,597,068 probably benign Het
R3hcc1 A G 14: 69,698,611 S250P probably damaging Het
Rere T A 4: 150,477,452 Y272N unknown Het
Selplg A G 5: 113,819,063 V394A probably benign Het
Senp7 T G 16: 56,165,883 F559V probably damaging Het
Slc16a7 T G 10: 125,233,439 probably null Het
Smim3 A T 18: 60,475,484 V32D probably damaging Het
Spsb3 A G 17: 24,890,296 D47G probably damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Stk11 T C 10: 80,126,377 probably benign Het
Susd1 A T 4: 59,329,491 L646Q possibly damaging Het
Tmprss11a A G 5: 86,428,578 V138A probably benign Het
Ttn T C 2: 76,750,470 K15033E probably damaging Het
Ttn C A 2: 76,898,625 probably benign Het
Tyrp1 G T 4: 80,837,512 D173Y probably damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Vamp4 A T 1: 162,577,888 D28V possibly damaging Het
Vmn2r78 C T 7: 86,920,244 S115F probably benign Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Akr1c20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Akr1c20 APN 13 4512665 critical splice donor site probably null
IGL01799:Akr1c20 APN 13 4514258 splice site probably null
IGL01930:Akr1c20 APN 13 4507648 intron probably benign
IGL02277:Akr1c20 APN 13 4514405 missense probably benign 0.01
IGL02811:Akr1c20 APN 13 4512683 missense possibly damaging 0.86
IGL03349:Akr1c20 APN 13 4508250 nonsense probably null
R0165:Akr1c20 UTSW 13 4523296 missense probably benign 0.02
R0193:Akr1c20 UTSW 13 4511293 splice site probably benign
R0440:Akr1c20 UTSW 13 4487208 missense probably benign 0.01
R1248:Akr1c20 UTSW 13 4514400 missense possibly damaging 0.52
R1396:Akr1c20 UTSW 13 4507727 missense probably damaging 1.00
R1735:Akr1c20 UTSW 13 4487208 missense probably benign 0.00
R2325:Akr1c20 UTSW 13 4523296 missense probably benign 0.02
R2359:Akr1c20 UTSW 13 4523277 missense probably damaging 0.96
R2878:Akr1c20 UTSW 13 4507775 missense probably damaging 1.00
R3712:Akr1c20 UTSW 13 4510223 missense probably damaging 1.00
R4514:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4544:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4545:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4781:Akr1c20 UTSW 13 4508175 nonsense probably null
R5301:Akr1c20 UTSW 13 4523280 missense probably damaging 1.00
R5826:Akr1c20 UTSW 13 4510223 missense probably damaging 1.00
R7122:Akr1c20 UTSW 13 4511276 missense probably benign 0.01
R7661:Akr1c20 UTSW 13 4508219 missense probably benign 0.00
R7832:Akr1c20 UTSW 13 4512672 missense probably damaging 1.00
R7915:Akr1c20 UTSW 13 4512672 missense probably damaging 1.00
Z1177:Akr1c20 UTSW 13 4523244 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGACTATCAACAATGTATTTCGGG -3'
(R):5'- TTCCATGTACTGAAAATCCTGGC -3'

Sequencing Primer
(F):5'- CTGTGTAGGTGCCTAATACCCAAAG -3'
(R):5'- AATCCTGGCATATATATCAACCTTCC -3'
Posted On2016-02-25