Incidental Mutation 'R4487:Nmu'
ID371139
Institutional Source Beutler Lab
Gene Symbol Nmu
Ensembl Gene ENSMUSG00000029236
Gene Nameneuromedin U
Synonyms
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76333495-76363788 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 76344062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031146] [ENSMUST00000031146] [ENSMUST00000031146]
Predicted Effect probably null
Transcript: ENSMUST00000031146
SMART Domains Protein: ENSMUSP00000031146
Gene: ENSMUSG00000029236

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
Pfam:NMU 144 166 1.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031146
SMART Domains Protein: ENSMUSP00000031146
Gene: ENSMUSG00000029236

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
Pfam:NMU 144 166 1.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031146
SMART Domains Protein: ENSMUSP00000031146
Gene: ENSMUSG00000029236

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
Pfam:NMU 144 166 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132154
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in pain, stress, immune-mediated inflammatory diseases and feeding regulation. Increased expression of this gene was observed in renal, pancreatic and lung cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. Some of these isoforms may undergo similar processing to generate the mature peptide. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice are healthy and viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Nmu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Nmu APN 5 76343927 missense probably damaging 0.97
IGL01459:Nmu APN 5 76358349 critical splice donor site probably null
IGL01511:Nmu APN 5 76340821 missense probably damaging 0.98
R1387:Nmu UTSW 5 76350145 nonsense probably null
R5514:Nmu UTSW 5 76350132 missense probably damaging 0.96
R6408:Nmu UTSW 5 76343971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGGCTACACCATCAG -3'
(R):5'- GTAGTGTAACTTCCTGTCCCAC -3'

Sequencing Primer
(F):5'- TGGTCTTACTACGTGCTAGATAAATC -3'
(R):5'- CATTGATTTTTGAGCAACGGATG -3'
Posted On2016-02-25