Incidental Mutation 'R4487:Nmu'
ID 371139
Institutional Source Beutler Lab
Gene Symbol Nmu
Ensembl Gene ENSMUSG00000029236
Gene Name neuromedin U
Synonyms
MMRRC Submission 041743-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4487 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 76481342-76511624 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 76491909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031146] [ENSMUST00000031146] [ENSMUST00000031146]
AlphaFold Q9QXK8
Predicted Effect probably null
Transcript: ENSMUST00000031146
SMART Domains Protein: ENSMUSP00000031146
Gene: ENSMUSG00000029236

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
Pfam:NMU 144 166 1.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031146
SMART Domains Protein: ENSMUSP00000031146
Gene: ENSMUSG00000029236

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
Pfam:NMU 144 166 1.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031146
SMART Domains Protein: ENSMUSP00000031146
Gene: ENSMUSG00000029236

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
Pfam:NMU 144 166 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132154
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in pain, stress, immune-mediated inflammatory diseases and feeding regulation. Increased expression of this gene was observed in renal, pancreatic and lung cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. Some of these isoforms may undergo similar processing to generate the mature peptide. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice are healthy and viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,651,931 (GRCm39) L99P probably damaging Het
Abcd2 A G 15: 91,062,486 (GRCm39) V484A probably damaging Het
Adgrv1 A G 13: 81,588,185 (GRCm39) I4467T probably damaging Het
Ash1l T A 3: 88,892,622 (GRCm39) D1500E possibly damaging Het
C1ql2 A T 1: 120,269,409 (GRCm39) Y188F possibly damaging Het
Cnga2 T A X: 71,049,733 (GRCm39) F133I possibly damaging Het
Crybg2 T C 4: 133,801,512 (GRCm39) S891P probably benign Het
Hao2 T A 3: 98,789,341 (GRCm39) I116F probably damaging Het
Htr1b A T 9: 81,513,592 (GRCm39) D338E probably benign Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kif9 A G 9: 110,323,552 (GRCm39) E225G probably null Het
Krt76 T C 15: 101,798,917 (GRCm39) K256R possibly damaging Het
Mapk4 T C 18: 74,064,046 (GRCm39) D392G probably damaging Het
Mthfr A G 4: 148,135,884 (GRCm39) K278R probably benign Het
Mup4 T A 4: 59,960,547 (GRCm39) E18V probably damaging Het
Nepro A G 16: 44,556,089 (GRCm39) K416E probably damaging Het
Ngf G A 3: 102,428,015 (GRCm39) D255N probably damaging Het
Nt5m A G 11: 59,739,173 (GRCm39) Y73C probably damaging Het
Oaz3 A T 3: 94,342,437 (GRCm39) probably null Het
Pgap1 A G 1: 54,567,751 (GRCm39) S365P probably benign Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pus7l A G 15: 94,429,498 (GRCm39) I440T possibly damaging Het
Raph1 C T 1: 60,542,028 (GRCm39) S362N possibly damaging Het
Rftn2 A G 1: 55,241,311 (GRCm39) Y330H possibly damaging Het
Rhot2 G A 17: 26,058,467 (GRCm39) H580Y probably benign Het
Rnase2a A T 14: 51,493,302 (GRCm39) M21K unknown Het
Rusf1 T C 7: 127,887,530 (GRCm39) D24G probably damaging Het
Smchd1 T C 17: 71,714,230 (GRCm39) T878A probably benign Het
Snx1 A T 9: 65,996,877 (GRCm39) V459E possibly damaging Het
Suz12 A G 11: 79,922,939 (GRCm39) T694A probably benign Het
Tg G A 15: 66,543,245 (GRCm39) C53Y probably damaging Het
Tor1aip1 G T 1: 155,882,870 (GRCm39) T326K probably damaging Het
Vmn1r61 C A 7: 5,613,924 (GRCm39) C130F possibly damaging Het
Xlr5b T C X: 72,201,504 (GRCm39) probably null Het
Other mutations in Nmu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Nmu APN 5 76,491,774 (GRCm39) missense probably damaging 0.97
IGL01459:Nmu APN 5 76,506,196 (GRCm39) critical splice donor site probably null
IGL01511:Nmu APN 5 76,488,668 (GRCm39) missense probably damaging 0.98
R1387:Nmu UTSW 5 76,497,992 (GRCm39) nonsense probably null
R5514:Nmu UTSW 5 76,497,979 (GRCm39) missense probably damaging 0.96
R6408:Nmu UTSW 5 76,491,818 (GRCm39) missense probably damaging 1.00
R8517:Nmu UTSW 5 76,493,326 (GRCm39) missense possibly damaging 0.62
R9115:Nmu UTSW 5 76,511,572 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGGGCTACACCATCAG -3'
(R):5'- GTAGTGTAACTTCCTGTCCCAC -3'

Sequencing Primer
(F):5'- TGGTCTTACTACGTGCTAGATAAATC -3'
(R):5'- CATTGATTTTTGAGCAACGGATG -3'
Posted On 2016-02-25