Incidental Mutation 'R4254:Slc38a1'
ID371143
Institutional Source Beutler Lab
Gene Symbol Slc38a1
Ensembl Gene ENSMUSG00000023169
Gene Namesolute carrier family 38, member 1
SynonymsNAT2
MMRRC Submission 041067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4254 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96571418-96642913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96585550 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 299 (D299G)
Ref Sequence ENSEMBL: ENSMUSP00000097833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088452] [ENSMUST00000088454] [ENSMUST00000100262]
Predicted Effect probably benign
Transcript: ENSMUST00000088452
AA Change: D299G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085799
Gene: ENSMUSG00000023169
AA Change: D299G

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 6.1e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088454
AA Change: D299G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085801
Gene: ENSMUSG00000023169
AA Change: D299G

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100262
AA Change: D299G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097833
Gene: ENSMUSG00000023169
AA Change: D299G

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230756
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,005,902 probably null Het
Adgrg2 T G X: 160,482,408 S551R possibly damaging Het
AI413582 A T 17: 27,565,722 probably null Het
Anapc2 T C 2: 25,273,345 V198A probably benign Het
Asxl3 T C 18: 22,524,366 I1811T possibly damaging Het
Atp5g3 A C 2: 73,909,975 probably benign Het
Ccdc27 A C 4: 154,039,519 S186A unknown Het
Ccdc28a A G 10: 18,224,935 L48P probably damaging Het
Cdh19 C T 1: 110,925,030 A392T probably damaging Het
Cfap65 T C 1: 74,903,358 D1679G probably benign Het
Copa C T 1: 172,102,244 R293C probably damaging Het
Depdc1a A G 3: 159,498,487 R58G probably damaging Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dsg4 A T 18: 20,471,538 T1021S probably benign Het
Hrh1 T A 6: 114,480,001 M81K probably damaging Het
Ipo11 G A 13: 106,892,509 T312I probably benign Het
Itgb2l T C 16: 96,430,577 N330D probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kcnb1 A G 2: 167,105,731 I399T probably damaging Het
Muc13 G A 16: 33,815,851 M568I probably benign Het
Nlrp1a A C 11: 71,123,028 Y465* probably null Het
Nwd2 G A 5: 63,806,546 V1158I possibly damaging Het
Olfr1162 C T 2: 88,049,779 V282I possibly damaging Het
Olfr888 T A 9: 38,109,250 L183H probably damaging Het
Olfr93 A G 17: 37,151,639 I111T possibly damaging Het
Ptprr T A 10: 116,162,443 probably null Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc3 T A 2: 163,636,968 M80L probably benign Het
Sf1 T C 19: 6,371,647 V140A probably damaging Het
Slc15a2 A T 16: 36,754,490 V519E probably benign Het
Slc16a10 A G 10: 40,077,001 Y166H probably damaging Het
Tmbim1 C A 1: 74,293,931 V92F probably damaging Het
Vsig4 C A X: 96,290,501 R134L probably benign Het
Other mutations in Slc38a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc38a1 APN 15 96585623 missense possibly damaging 0.89
IGL01376:Slc38a1 APN 15 96585556 missense probably damaging 1.00
IGL01920:Slc38a1 APN 15 96586897 missense probably benign
IGL01993:Slc38a1 APN 15 96624046 missense probably damaging 1.00
IGL02201:Slc38a1 APN 15 96578798 missense probably damaging 1.00
IGL03074:Slc38a1 APN 15 96592524 missense possibly damaging 0.72
IGL03370:Slc38a1 APN 15 96579347 missense possibly damaging 0.93
R0918:Slc38a1 UTSW 15 96609862 missense probably damaging 1.00
R1506:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R1510:Slc38a1 UTSW 15 96609860 missense probably damaging 1.00
R1713:Slc38a1 UTSW 15 96578760 missense probably damaging 1.00
R1721:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R1867:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R4255:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4754:Slc38a1 UTSW 15 96576782 missense probably damaging 0.98
R5548:Slc38a1 UTSW 15 96590474 missense probably damaging 1.00
R5610:Slc38a1 UTSW 15 96616141 critical splice donor site probably null
R6235:Slc38a1 UTSW 15 96578792 missense probably benign 0.36
R6288:Slc38a1 UTSW 15 96586878 missense probably benign 0.12
R7904:Slc38a1 UTSW 15 96624040 missense possibly damaging 0.95
R8195:Slc38a1 UTSW 15 96592566 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAAGATACTACTCCCCATTCTGG -3'
(R):5'- TTGCGGCTCATATCTGAAGACC -3'

Sequencing Primer
(F):5'- TGGAGCTTCCTTAACACAGG -3'
(R):5'- GGCTCATATCTGAAGACCATAGTC -3'
Posted On2016-02-25