Incidental Mutation 'R4417:Cdc23'
ID371146
Institutional Source Beutler Lab
Gene Symbol Cdc23
Ensembl Gene ENSMUSG00000024370
Gene NameCDC23 cell division cycle 23
SynonymsD18Ertd243e
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4417 (G1)
Quality Score143
Status Validated
Chromosome18
Chromosomal Location34630951-34651735 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACC to AC at 34637318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably null
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133162
Predicted Effect probably null
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155307
Predicted Effect probably benign
Transcript: ENSMUST00000166044
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Cdc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cdc23 APN 18 34636332 missense probably benign 0.01
IGL01302:Cdc23 APN 18 34634644 missense probably benign 0.19
IGL01859:Cdc23 APN 18 34651406 missense probably benign 0.01
IGL02307:Cdc23 APN 18 34641389 missense possibly damaging 0.71
IGL03081:Cdc23 APN 18 34636704 missense probably damaging 1.00
IGL03086:Cdc23 APN 18 34637186 unclassified probably benign
IGL03089:Cdc23 APN 18 34634460 missense probably damaging 1.00
IGL03249:Cdc23 APN 18 34644016 splice site probably benign
R0217:Cdc23 UTSW 18 34651665 missense unknown
R0790:Cdc23 UTSW 18 34651613 missense possibly damaging 0.94
R1593:Cdc23 UTSW 18 34636326 missense possibly damaging 0.88
R2929:Cdc23 UTSW 18 34637318 frame shift probably null
R2930:Cdc23 UTSW 18 34637318 frame shift probably null
R3963:Cdc23 UTSW 18 34646919 missense probably benign 0.01
R3983:Cdc23 UTSW 18 34637486 unclassified probably benign
R4245:Cdc23 UTSW 18 34637047 unclassified probably benign
R4415:Cdc23 UTSW 18 34637318 frame shift probably null
R4992:Cdc23 UTSW 18 34646919 missense probably benign
R5037:Cdc23 UTSW 18 34651689 missense unknown
R5071:Cdc23 UTSW 18 34651689 missense unknown
R5072:Cdc23 UTSW 18 34651689 missense unknown
R5073:Cdc23 UTSW 18 34651689 missense unknown
R5074:Cdc23 UTSW 18 34651689 missense unknown
R5081:Cdc23 UTSW 18 34651689 missense unknown
R5082:Cdc23 UTSW 18 34651689 missense unknown
R5083:Cdc23 UTSW 18 34651689 missense unknown
R5110:Cdc23 UTSW 18 34651689 missense unknown
R5111:Cdc23 UTSW 18 34651689 missense unknown
R5122:Cdc23 UTSW 18 34651689 missense unknown
R5131:Cdc23 UTSW 18 34651689 missense unknown
R5132:Cdc23 UTSW 18 34651689 missense unknown
R5166:Cdc23 UTSW 18 34651689 missense unknown
R7186:Cdc23 UTSW 18 34637122 missense probably damaging 1.00
R7359:Cdc23 UTSW 18 34641341 missense probably benign 0.40
R7732:Cdc23 UTSW 18 34636702 critical splice donor site probably null
R7832:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R7915:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R8031:Cdc23 UTSW 18 34651688 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCTCTGTAGTCTCTCTTGTTG -3'
(R):5'- ACCAATCTAAAGACGGCTTAGAAAA -3'

Sequencing Primer
(F):5'- GTTGACCTCAATGGCATGTC -3'
(R):5'- ATGCCAGATTTCATGGCACTG -3'
Posted On2016-02-25