Incidental Mutation 'R4326:Rrs1'
ID 371150
Institutional Source Beutler Lab
Gene Symbol Rrs1
Ensembl Gene ENSMUSG00000061024
Gene Name ribosome biogenesis regulator 1
Synonyms 5730466A07Rik, D1Ertd701e
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4326 (G1)
Quality Score 31
Status Validated
Chromosome 1
Chromosomal Location 9545408-9547455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 9546341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 273 (R273L)
Ref Sequence ENSEMBL: ENSMUSP00000071955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
AlphaFold Q9CYH6
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect possibly damaging
Transcript: ENSMUST00000072079
AA Change: R273L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024
AA Change: R273L

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130927
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Meta Mutation Damage Score 0.1014 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Rrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03098:Rrs1 UTSW 1 9546103 frame shift probably null
PIT1430001:Rrs1 UTSW 1 9545925 missense probably damaging 1.00
R0207:Rrs1 UTSW 1 9545762 splice site probably null
R0207:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R0577:Rrs1 UTSW 1 9545801 splice site probably null
R1165:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R1222:Rrs1 UTSW 1 9545855 missense probably benign 0.00
R1238:Rrs1 UTSW 1 9545801 splice site probably null
R1397:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R1598:Rrs1 UTSW 1 9545912 missense probably benign 0.15
R2338:Rrs1 UTSW 1 9545801 splice site probably null
R4280:Rrs1 UTSW 1 9546139 missense probably damaging 0.96
R4287:Rrs1 UTSW 1 9546215 missense probably damaging 1.00
R4287:Rrs1 UTSW 1 9546223 missense possibly damaging 0.82
R4298:Rrs1 UTSW 1 9546223 missense possibly damaging 0.82
R4475:Rrs1 UTSW 1 9545585 missense probably damaging 1.00
R4566:Rrs1 UTSW 1 9546227 missense probably damaging 1.00
R4986:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R6597:Rrs1 UTSW 1 9546376 missense probably damaging 0.98
R7529:Rrs1 UTSW 1 9546192 missense probably benign
R7728:Rrs1 UTSW 1 9546398 missense possibly damaging 0.78
R8134:Rrs1 UTSW 1 9545420 unclassified probably benign
R8799:Rrs1 UTSW 1 9545594 missense probably damaging 1.00
R9060:Rrs1 UTSW 1 9546452 missense probably damaging 1.00
R9360:Rrs1 UTSW 1 9546620 makesense probably null
R9609:Rrs1 UTSW 1 9546293 missense probably benign 0.30
R9685:Rrs1 UTSW 1 9546165 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AAGATGCAGATGCCCAGCTC -3'
(R):5'- TGCCAGCTAAAGCAGAAGGC -3'

Sequencing Primer
(F):5'- GCCTGCACCCTACTGGACAC -3'
(R):5'- AGGAATGCTTTTTGCTTCCCAAG -3'
Posted On 2016-02-26