Incidental Mutation 'R4274:Csn1s1'
ID371158
Institutional Source Beutler Lab
Gene Symbol Csn1s1
Ensembl Gene ENSMUSG00000070702
Gene Namecasein alpha s1
SynonymsCsna
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87666208-87682578 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 87680961 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 295 (*295R)
Ref Sequence ENSEMBL: ENSMUSP00000142794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094641] [ENSMUST00000197157] [ENSMUST00000197631]
Predicted Effect probably null
Transcript: ENSMUST00000094641
AA Change: *314R
SMART Domains Protein: ENSMUSP00000092225
Gene: ENSMUSG00000070702
AA Change: *314R

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 74 102 N/A INTRINSIC
internal_repeat_1 117 148 7.63e-5 PROSPERO
internal_repeat_1 141 172 7.63e-5 PROSPERO
low complexity region 173 198 N/A INTRINSIC
Pfam:Casein 215 304 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197157
SMART Domains Protein: ENSMUSP00000142839
Gene: ENSMUSG00000070702

DomainStartEndE-ValueType
low complexity region 16 44 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197631
AA Change: *295R
SMART Domains Protein: ENSMUSP00000142794
Gene: ENSMUSG00000070702
AA Change: *295R

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 74 102 N/A INTRINSIC
internal_repeat_1 117 148 3.17e-5 PROSPERO
internal_repeat_1 141 172 3.17e-5 PROSPERO
low complexity region 173 198 N/A INTRINSIC
Pfam:Casein 215 282 4.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199533
Meta Mutation Damage Score 0.8580 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced milk prodution and abnormal milk composition with reduced protein, calcium and phosphate concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Csn1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Csn1s1 APN 5 87667259 missense probably benign 0.03
IGL01984:Csn1s1 APN 5 87676510 unclassified probably benign
IGL02183:Csn1s1 APN 5 87677618 missense possibly damaging 0.52
IGL02335:Csn1s1 APN 5 87680845 missense probably benign 0.09
IGL02496:Csn1s1 APN 5 87677594 unclassified probably benign
IGL02502:Csn1s1 APN 5 87680925 missense probably benign 0.06
IGL02622:Csn1s1 APN 5 87677642 critical splice donor site probably null
IGL03403:Csn1s1 APN 5 87667293 missense probably benign 0.19
R0004:Csn1s1 UTSW 5 87671531 missense probably benign 0.01
R0472:Csn1s1 UTSW 5 87677627 missense possibly damaging 0.71
R1076:Csn1s1 UTSW 5 87676383 splice site probably null
R1364:Csn1s1 UTSW 5 87677584 unclassified probably benign
R1761:Csn1s1 UTSW 5 87679035 missense probably benign 0.32
R2056:Csn1s1 UTSW 5 87671528 missense possibly damaging 0.66
R2937:Csn1s1 UTSW 5 87677136 missense possibly damaging 0.52
R2938:Csn1s1 UTSW 5 87677136 missense possibly damaging 0.52
R3793:Csn1s1 UTSW 5 87680843 nonsense probably null
R4568:Csn1s1 UTSW 5 87680904 missense possibly damaging 0.51
R4959:Csn1s1 UTSW 5 87673261 missense probably benign 0.27
R4973:Csn1s1 UTSW 5 87673261 missense probably benign 0.27
R5133:Csn1s1 UTSW 5 87680878 missense possibly damaging 0.92
R5611:Csn1s1 UTSW 5 87677644 splice site probably null
R6008:Csn1s1 UTSW 5 87678085 critical splice donor site probably null
R6663:Csn1s1 UTSW 5 87675740 missense probably benign 0.33
R6940:Csn1s1 UTSW 5 87675023 missense possibly damaging 0.46
R7164:Csn1s1 UTSW 5 87674228 missense possibly damaging 0.53
R7998:Csn1s1 UTSW 5 87674228 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GAGAGACACTAACAGCAATTGC -3'
(R):5'- TGGGTGTCACTGACTGAATG -3'

Sequencing Primer
(F):5'- GCAATTGCTCACACATTTTGTTTTG -3'
(R):5'- GACTGAATGTAGAATTTTGCTCTCCG -3'
Posted On2016-02-29