Incidental Mutation 'R4454:Liph'
ID371162
Institutional Source Beutler Lab
Gene Symbol Liph
Ensembl Gene ENSMUSG00000044626
Gene Namelipase, member H
SynonymsD16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr
MMRRC Submission 041714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4454 (G1)
Quality Score182
Status Validated
Chromosome16
Chromosomal Location21953817-21995663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21984268 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000073853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]
Predicted Effect probably benign
Transcript: ENSMUST00000060673
AA Change: D17G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: D17G

DomainStartEndE-ValueType
Pfam:Lipase 11 326 6.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074230
AA Change: D17G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: D17G

DomainStartEndE-ValueType
Pfam:Lipase 15 214 1.5e-45 PFAM
Pfam:Abhydrolase_6 73 296 2.3e-6 PFAM
Pfam:Lipase 209 296 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231682
AA Change: D17G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000231766
AA Change: D17G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.5493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,753 E163G probably damaging Het
AI481877 T C 4: 59,092,383 D266G possibly damaging Het
Ap4e1 T A 2: 127,047,141 F509I probably damaging Het
Asmt A T X: 170,672,721 M19L probably benign Het
Atf6 C T 1: 170,794,039 R471Q probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baiap3 T A 17: 25,249,536 D250V probably damaging Het
C2cd4d T A 3: 94,363,747 F107I probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cldn6 T C 17: 23,681,086 probably null Het
Cpa5 A G 6: 30,626,324 N228S possibly damaging Het
Crocc T C 4: 141,020,405 S1478G possibly damaging Het
Csmd1 A T 8: 15,945,011 C2675S probably damaging Het
Cthrc1 C A 15: 39,077,013 Q4K probably benign Het
Ddo A T 10: 40,647,547 I178F probably damaging Het
Dmxl1 A G 18: 49,893,332 T1836A probably benign Het
Dnah9 T G 11: 66,147,389 Q107P probably damaging Het
Dusp26 A G 8: 31,094,144 N93S probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Epha5 T C 5: 84,156,444 I501V probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fgd5 C T 6: 91,989,186 S642F probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gm12034 T A 11: 20,446,476 noncoding transcript Het
Gm13023 A G 4: 143,792,824 S52G probably benign Het
Mbd3 A T 10: 80,393,983 L164H probably damaging Het
Med4 A G 14: 73,518,062 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav2 A T 7: 49,548,544 probably null Het
Olfr728 T C 14: 50,140,496 I48V probably benign Het
Olfr904 C A 9: 38,464,642 F200L probably benign Het
Pcdha11 G A 18: 37,007,373 G685D probably benign Het
Pgc A G 17: 47,732,410 I228V probably benign Het
Rad51 C T 2: 119,131,568 H199Y probably damaging Het
Robo2 A T 16: 74,352,519 probably benign Het
Sap130 C T 18: 31,711,360 T861I probably damaging Het
Sh3tc2 A T 18: 62,007,773 D1061V probably damaging Het
Snapc3 A G 4: 83,418,759 E119G probably damaging Het
Sspo G A 6: 48,487,225 G3862D probably benign Het
Tbc1d16 G A 11: 119,157,873 T318M possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Thsd1 T C 8: 22,243,578 Y214H probably damaging Het
Tnfrsf13b T C 11: 61,141,438 V98A probably benign Het
Topbp1 T C 9: 103,344,871 Y1314H probably damaging Het
Ttn C A 2: 76,785,806 V8271L possibly damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utrn G T 10: 12,727,840 Q599K possibly damaging Het
Zfp995 G A 17: 21,879,951 T434I probably benign Het
Zfy1 G T Y: 725,518 T749K possibly damaging Het
Other mutations in Liph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Liph APN 16 21968140 missense probably damaging 1.00
babyback UTSW 16 21983957 missense probably damaging 0.97
PIT4131001:Liph UTSW 16 21995369 start codon destroyed probably null 0.59
R0004:Liph UTSW 16 21984194 nonsense probably null
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0348:Liph UTSW 16 21967980 splice site probably null
R0689:Liph UTSW 16 21968068 missense probably damaging 1.00
R0715:Liph UTSW 16 21995350 missense probably benign 0.05
R1104:Liph UTSW 16 21984148 missense possibly damaging 0.82
R1779:Liph UTSW 16 21968050 missense probably benign 0.01
R2323:Liph UTSW 16 21984004 missense probably damaging 0.99
R3913:Liph UTSW 16 21962259 splice site probably benign
R4402:Liph UTSW 16 21976250 missense probably damaging 1.00
R4672:Liph UTSW 16 21984056 missense probably benign 0.14
R4681:Liph UTSW 16 21984027 missense probably benign 0.02
R5111:Liph UTSW 16 21984070 missense probably damaging 1.00
R5135:Liph UTSW 16 21956165 nonsense probably null
R5235:Liph UTSW 16 21984035 missense probably damaging 1.00
R5642:Liph UTSW 16 21965995 missense possibly damaging 0.61
R5810:Liph UTSW 16 21968110 missense probably damaging 1.00
R6188:Liph UTSW 16 21984268 missense probably benign 0.11
R6557:Liph UTSW 16 21983920 missense possibly damaging 0.60
R6734:Liph UTSW 16 21983957 missense probably damaging 0.97
R7011:Liph UTSW 16 21984097 missense probably damaging 0.98
R7038:Liph UTSW 16 21976259 missense probably damaging 1.00
R7178:Liph UTSW 16 21976328 missense probably damaging 1.00
R7185:Liph UTSW 16 21995339 missense probably benign 0.00
R7198:Liph UTSW 16 21966022 missense probably damaging 1.00
R7775:Liph UTSW 16 21958914 missense probably damaging 1.00
R7832:Liph UTSW 16 21962236 missense probably benign 0.01
R7993:Liph UTSW 16 21958812 missense probably benign 0.03
R8264:Liph UTSW 16 21983971 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATCAAACTCTGTACCAGCTCC -3'
(R):5'- TCACTGAACTAGCTCCAGGC -3'

Sequencing Primer
(F):5'- TGTTGGCCGGAAACCGTG -3'
(R):5'- CTCTGGGGAGGCGCTGTG -3'
Posted On2016-02-29