Incidental Mutation 'R4422:Plcb2'
ID371170
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission 041695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4422 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118712003 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 821 (K821E)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006415
Predicted Effect probably benign
Transcript: ENSMUST00000102524
AA Change: K844E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: K844E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129153
Predicted Effect probably benign
Transcript: ENSMUST00000159756
AA Change: K821E

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: K821E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dhx29 T C 13: 112,947,247 L612P probably damaging Het
Dlgap2 T C 8: 14,743,463 probably null Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Mon2 A G 10: 123,042,982 L218P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr5 G T 7: 6,481,038 Y39* probably null Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Vsig10 T C 5: 117,324,921 S71P probably benign Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp871 C A 17: 32,774,833 S456I probably benign Het
Zfp871 T A 17: 32,774,834 S437C probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118711388 missense probably benign
R8152:Plcb2 UTSW 2 118710821 missense probably benign 0.22
R8170:Plcb2 UTSW 2 118711453 missense possibly damaging 0.68
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118723128 missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118709200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTTGAGGCTTCCGATTCAG -3'
(R):5'- TCTTACAGTAGCCCTTGCCAAC -3'

Sequencing Primer
(F):5'- GATCTTCCCTCCCCGGATGAAAG -3'
(R):5'- TTCAATGCCCAGGATAAGAAGTCCG -3'
Posted On2016-02-29