Mutagenetix > Incidental Mutations

Incidental Mutation 'R4822:Olfr350'

371178

Institutional Source

Beutler Lab

Gene Symbol

Olfr350

Ensembl Gene

ENSMUSG00000050015

Gene Name

olfactory receptor 350

Synonyms

MOR136-13, GA_x6K02T2NLDC-33544602-33545540

MMRRC Submission

042438-MU

Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R4822 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36846310-36851702 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36850876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 277 (M277V)

Ref Sequence

ENSEMBL: ENSMUSP00000149667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]

AlphaFold

Q8VFP8

Predicted Effect

probably benign
Transcript: ENSMUST00000055130
AA Change: M277V

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: M277V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	6.3e-61	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.3e-7	PFAM
Pfam:7tm_1	41	290	3e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214457
AA Change: M277V

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000215100
AA Change: M277V

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.1503

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	C	T	14: 70,156,458	V243I	probably benign	Het
Acadvl	C	T	11: 70,011,184	G485S	probably benign	Het
Acap3	T	A	4: 155,902,451		probably benign	Het
Adamts19	A	G	18: 58,890,284	I250M	probably damaging	Het
AF067061	A	T	13: 120,264,150	T117S	probably damaging	Het
Amacr	T	A	15: 10,983,410	I102N	probably damaging	Het
Apob	A	G	12: 8,015,741	T4237A	probably benign	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Bicd1	A	T	6: 149,519,254		probably benign	Het
Caskin2	T	A	11: 115,807,299	E49V	probably damaging	Het
Cemip	T	A	7: 83,973,241	I577F	probably benign	Het
Chrnb1	T	C	11: 69,795,675	S40G	possibly damaging	Het
Ctif	C	T	18: 75,521,561	C298Y	probably benign	Het
Cul9	A	C	17: 46,530,051	H764Q	probably benign	Het
Cwf19l2	T	A	9: 3,458,839	C763S	probably damaging	Het
Dhx57	A	T	17: 80,242,167		probably null	Het
Dnhd1	G	A	7: 105,703,964	D2775N	probably benign	Het
Enpp1	A	T	10: 24,661,935	M384K	possibly damaging	Het
Fat2	T	C	11: 55,311,318	N310S	probably benign	Het
Fbxw7	A	T	3: 84,967,507	Y232F	possibly damaging	Het
Fcamr	T	A	1: 130,812,686	S281T	possibly damaging	Het
Gm10762	C	T	2: 128,967,186	W81*	probably null	Het
Gm5592	A	G	7: 41,155,890		probably benign	Het
Gm5745	T	C	9: 73,175,698		noncoding transcript	Het
Gm6185	G	C	1: 161,213,254		noncoding transcript	Het
Hid1	T	A	11: 115,355,299	N382Y	probably damaging	Het
Hoxa10	A	T	6: 52,232,589	F68I	probably damaging	Het
Ift88	T	A	14: 57,441,869		probably null	Het
Ighg2b	A	T	12: 113,306,391	*336R	probably null	Het
Ighv7-2	A	C	12: 113,912,272	L37R	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnn3	G	C	3: 89,667,289	V703L	possibly damaging	Het
Kiz	C	A	2: 146,891,069	S388R	probably damaging	Het
Klhl20	G	A	1: 161,093,763	Q41*	probably null	Het
Krt31	T	C	11: 100,047,784	I328V	possibly damaging	Het
Lama4	A	T	10: 39,033,053	I330L	probably benign	Het
Lipo2	A	T	19: 33,745,751	S213T	probably benign	Het
Lrsam1	A	T	2: 32,926,792	I723N	probably damaging	Het
Man2b2	G	A	5: 36,815,521	R550W	probably damaging	Het
Map4k5	A	T	12: 69,841,984	L224*	probably null	Het
Mast3	A	G	8: 70,780,366	S1101P	probably damaging	Het
Mertk	A	G	2: 128,801,305	S875G	probably benign	Het
Mmel1	A	G	4: 154,887,897	M302V	probably benign	Het
Mrgpra3	T	A	7: 47,589,968	H70L	possibly damaging	Het
Myh3	T	A	11: 67,089,010	S592T	probably benign	Het
Nbeal2	T	C	9: 110,636,315	I451V	possibly damaging	Het
Nup155	T	A	15: 8,128,526	V489D	possibly damaging	Het
Obscn	T	A	11: 59,022,333	T6300S	probably benign	Het
Olfr1294	G	T	2: 111,537,452	T279K	probably damaging	Het
Olfr1377	T	A	11: 50,985,083	C127*	probably null	Het
Olfr290	A	C	7: 84,916,426	I216L	possibly damaging	Het
Oprm1	A	G	10: 6,829,036	I146V	probably damaging	Het
Otub1	A	T	19: 7,204,429	D27E	probably damaging	Het
Pik3ca	T	C	3: 32,437,982	V243A	probably benign	Het
Pla2g12b	G	A	10: 59,416,514		probably null	Het
Plekha8	A	G	6: 54,624,561	D321G	probably damaging	Het
Pprc1	T	C	19: 46,071,356		probably benign	Het
Prkdc	A	G	16: 15,650,712	D129G	possibly damaging	Het
Rbms3	C	T	9: 116,944,373		probably benign	Het
Rictor	T	A	15: 6,791,680	V1495D	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,509		noncoding transcript	Het
Ryr3	A	T	2: 112,652,745	I4219N	probably damaging	Het
Sbf2	G	A	7: 110,377,939		probably benign	Het
Scn10a	C	T	9: 119,638,672	A801T	probably damaging	Het
Scn9a	T	A	2: 66,483,749	Y1866F	possibly damaging	Het
Sec1	A	C	7: 45,679,303	Y107D	probably damaging	Het
Sema6d	C	T	2: 124,662,294	T619M	possibly damaging	Het
Sh2b3	C	A	5: 121,828,555		probably benign	Het
Slc2a4	A	G	11: 69,946,587	V44A	probably damaging	Het
Slc5a12	T	C	2: 110,621,740	I326T	possibly damaging	Het
Smarca5	T	C	8: 80,708,680		probably null	Het
Smarcd2	A	G	11: 106,266,531		probably null	Het
Snrpa1	A	T	7: 66,069,573		probably benign	Het
Sptbn5	T	G	2: 120,067,968	K470Q	probably benign	Het
Stard9	T	G	2: 120,695,941	V893G	possibly damaging	Het
Stx8	T	G	11: 67,973,273	V53G	possibly damaging	Het
Sv2c	A	T	13: 95,985,949	W440R	probably damaging	Het
Tmem181a	A	T	17: 6,280,665	I67F	probably benign	Het
Tmprss7	C	T	16: 45,663,316	C565Y	probably damaging	Het
Trafd1	A	T	5: 121,378,498	L109H	probably damaging	Het
Trpv4	A	G	5: 114,630,022	I422T	possibly damaging	Het
Usp24	T	A	4: 106,416,047	Y2210N	probably damaging	Het
Vmn1r236	A	T	17: 21,286,940	N107Y	probably damaging	Het
Vmn2r13	A	T	5: 109,174,072	I253K	probably damaging	Het
Vmn2r2	T	A	3: 64,134,539	I252F	probably damaging	Het
Vsig8	A	G	1: 172,559,638	D27G	probably damaging	Het
Wdr92	T	A	11: 17,227,165	N174K	probably damaging	Het
Wiz	A	T	17: 32,356,437	Y908*	probably null	Het
Wnk1	A	T	6: 119,962,438	S1113T	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp691	G	T	4: 119,170,567	T156K	probably damaging	Het
Zfp791	A	T	8: 85,110,406	D276E	probably benign	Het

Other mutations in Olfr350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Olfr350	APN	2	36850270	missense	probably damaging	1.00
IGL01113:Olfr350	APN	2	36850619	missense	probably damaging	1.00
IGL01393:Olfr350	APN	2	36850541	missense	probably benign	0.01
IGL02302:Olfr350	APN	2	36850703	missense	probably benign	0.02
IGL02316:Olfr350	APN	2	36850282	missense	probably damaging	1.00
BB007:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
BB017:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
F6893:Olfr350	UTSW	2	36850807	missense	probably benign	0.00
PIT4402001:Olfr350	UTSW	2	36850304	missense	probably benign
R0312:Olfr350	UTSW	2	36850360	missense	probably benign	0.01
R0525:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R0557:Olfr350	UTSW	2	36850748	missense	possibly damaging	0.95
R0665:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R2019:Olfr350	UTSW	2	36850406	missense	possibly damaging	0.95
R2107:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2108:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2848:Olfr350	UTSW	2	36850799	missense	probably damaging	1.00
R3964:Olfr350	UTSW	2	36850717	missense	probably benign	0.12
R4907:Olfr350	UTSW	2	36850258	missense	probably benign	0.28
R5134:Olfr350	UTSW	2	36850476	missense	probably benign	0.03
R5144:Olfr350	UTSW	2	36850144	missense	probably benign
R5702:Olfr350	UTSW	2	36850934	missense	probably damaging	1.00
R5727:Olfr350	UTSW	2	36850532	missense	possibly damaging	0.80
R5786:Olfr350	UTSW	2	36850049	start codon destroyed	probably null	0.98
R6179:Olfr350	UTSW	2	36850834	missense	possibly damaging	0.59
R6862:Olfr350	UTSW	2	36850222	missense	possibly damaging	0.95
R7258:Olfr350	UTSW	2	36850340	missense	probably damaging	0.99
R7307:Olfr350	UTSW	2	36850125	missense	probably benign	0.00
R7353:Olfr350	UTSW	2	36850069	missense	probably benign
R7412:Olfr350	UTSW	2	36850466	missense	probably benign	0.28
R7851:Olfr350	UTSW	2	36850416	nonsense	probably null
R7930:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
R8005:Olfr350	UTSW	2	36850144	missense	probably benign
R8346:Olfr350	UTSW	2	36850339	missense	probably benign	0.02
R8692:Olfr350	UTSW	2	36850084	missense	probably benign	0.00
R9120:Olfr350	UTSW	2	36850131	nonsense	probably null
R9318:Olfr350	UTSW	2	36850553	missense	probably benign	0.12
Z1177:Olfr350	UTSW	2	36850239	missense	probably damaging	0.99
Z1177:Olfr350	UTSW	2	36850925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTACAACAGTCATTACTCTGC -3'
(R):5'- GCTCCATAATGAGACCACAAATGG -3'

Sequencing Primer
(F):5'- ATCTCTTATGGTCACATTGTGGC -3'
(R):5'- CACAAATGGAAGTGTAATATTTGGAG -3'

Posted On

2016-03-01