Incidental Mutation 'R0422:Fabp1'
ID37119
Institutional Source Beutler Lab
Gene Symbol Fabp1
Ensembl Gene ENSMUSG00000054422
Gene Namefatty acid binding protein 1, liver
SynonymsL-FABP, Fabpl
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R0422 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71199827-71205023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71203093 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 83 (V83I)
Ref Sequence ENSEMBL: ENSMUSP00000064655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067492
AA Change: V83I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064655
Gene: ENSMUSG00000054422
AA Change: V83I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 1 127 1.2e-32 PFAM
Pfam:Lipocalin 4 127 8.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene do not show any obvious morphological, behavioral, or reproductive abnormalities. Changes may be observed in lipid composition, lipid binding, or levels of lipid binding proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Fabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Fabp1 APN 6 71203144 missense probably damaging 1.00
R3437:Fabp1 UTSW 6 71201611 missense probably benign 0.44
R5218:Fabp1 UTSW 6 71199960 missense probably damaging 0.99
R7023:Fabp1 UTSW 6 71203085 critical splice acceptor site probably null
R7289:Fabp1 UTSW 6 71203127 missense probably benign 0.00
R8050:Fabp1 UTSW 6 71199972 missense probably damaging 1.00
X0063:Fabp1 UTSW 6 71201622 missense possibly damaging 0.91
Z1176:Fabp1 UTSW 6 71199955 missense possibly damaging 0.74
Z1177:Fabp1 UTSW 6 71201736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTATTTCCATTTAGCACCAAAGA -3'
(R):5'- ACCCTGATGCTGCCATTCGAC -3'

Sequencing Primer
(F):5'- TTCCATTTAGCACCAAAGAACTGG -3'
(R):5'- CCTTcacacacacacacacac -3'
Posted On2013-05-09