Incidental Mutation 'R0422:Ing1'
ID37124
Institutional Source Beutler Lab
Gene Symbol Ing1
Ensembl Gene ENSMUSG00000045969
Gene Nameinhibitor of growth family, member 1
Synonyms2610028J21Rik, p33Ing1, mING1h
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0422 (G1)
Quality Score220
Status Not validated
Chromosome8
Chromosomal Location11555571-11563251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11561933 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 124 (V124I)
Ref Sequence ENSEMBL: ENSMUSP00000148030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054399] [ENSMUST00000209565] [ENSMUST00000209646] [ENSMUST00000210041] [ENSMUST00000210670] [ENSMUST00000210740] [ENSMUST00000211007]
Predicted Effect probably damaging
Transcript: ENSMUST00000054399
AA Change: V218I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062593
Gene: ENSMUSG00000045969
AA Change: V218I

DomainStartEndE-ValueType
Pfam:ING 15 113 1.4e-33 PFAM
low complexity region 146 165 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
PHD 212 257 2.23e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209565
AA Change: V124I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209646
AA Change: V124I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000210041
AA Change: V124I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210670
Predicted Effect probably damaging
Transcript: ENSMUST00000210740
AA Change: V124I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211007
AA Change: V124I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a slight decrease in body weight, moderately impaired maternal nurturing, increased sensitivity to gamma-irradiation, and increased incidence of B-cell derived lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Ing1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ing1 APN 8 11561453 missense probably benign 0.33
F5770:Ing1 UTSW 8 11561934 missense probably damaging 1.00
R0546:Ing1 UTSW 8 11557031 missense probably damaging 1.00
R1295:Ing1 UTSW 8 11561501 missense probably benign 0.00
R1295:Ing1 UTSW 8 11561502 missense probably damaging 0.96
R1433:Ing1 UTSW 8 11557010 missense probably damaging 0.98
R1914:Ing1 UTSW 8 11561577 missense probably damaging 1.00
R2964:Ing1 UTSW 8 11561641 missense probably benign 0.09
R2965:Ing1 UTSW 8 11561641 missense probably benign 0.09
R4559:Ing1 UTSW 8 11562090 missense probably benign 0.01
R6884:Ing1 UTSW 8 11561916 missense probably damaging 1.00
R7775:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7778:Ing1 UTSW 8 11561814 missense probably benign 0.00
R7824:Ing1 UTSW 8 11561814 missense probably benign 0.00
V7583:Ing1 UTSW 8 11561934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGATGACATCACCTCAGGAACG -3'
(R):5'- ACTTCCACGAAGGCAGCGATAC -3'

Sequencing Primer
(F):5'- CTCAGGAACGCCCAAGGAG -3'
(R):5'- TGGCTGTGTCACTGACCAC -3'
Posted On2013-05-09