Incidental Mutation 'R4822:Apob'
ID371240
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 042438-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R4822 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8015741 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 4237 (T4237A)
Ref Sequence ENSEMBL: ENSMUSP00000036044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: T4204A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: T4204A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037811
AA Change: T4237A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: T4237A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171239
SMART Domains Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
low complexity region 348 356 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik C T 14: 70,156,458 V243I probably benign Het
Acadvl C T 11: 70,011,184 G485S probably benign Het
Acap3 T A 4: 155,902,451 probably benign Het
Adamts19 A G 18: 58,890,284 I250M probably damaging Het
AF067061 A T 13: 120,264,150 T117S probably damaging Het
Amacr T A 15: 10,983,410 I102N probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bicd1 A T 6: 149,519,254 probably benign Het
Caskin2 T A 11: 115,807,299 E49V probably damaging Het
Cemip T A 7: 83,973,241 I577F probably benign Het
Chrnb1 T C 11: 69,795,675 S40G possibly damaging Het
Ctif C T 18: 75,521,561 C298Y probably benign Het
Cul9 A C 17: 46,530,051 H764Q probably benign Het
Cwf19l2 T A 9: 3,458,839 C763S probably damaging Het
Dhx57 A T 17: 80,242,167 probably null Het
Dnhd1 G A 7: 105,703,964 D2775N probably benign Het
Enpp1 A T 10: 24,661,935 M384K possibly damaging Het
Fat2 T C 11: 55,311,318 N310S probably benign Het
Fbxw7 A T 3: 84,967,507 Y232F possibly damaging Het
Fcamr T A 1: 130,812,686 S281T possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm5592 A G 7: 41,155,890 probably benign Het
Gm5745 T C 9: 73,175,698 noncoding transcript Het
Gm6185 G C 1: 161,213,254 noncoding transcript Het
Hid1 T A 11: 115,355,299 N382Y probably damaging Het
Hoxa10 A T 6: 52,232,589 F68I probably damaging Het
Ift88 T A 14: 57,441,869 probably null Het
Ighg2b A T 12: 113,306,391 *336R probably null Het
Ighv7-2 A C 12: 113,912,272 L37R probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn3 G C 3: 89,667,289 V703L possibly damaging Het
Kiz C A 2: 146,891,069 S388R probably damaging Het
Klhl20 G A 1: 161,093,763 Q41* probably null Het
Krt31 T C 11: 100,047,784 I328V possibly damaging Het
Lama4 A T 10: 39,033,053 I330L probably benign Het
Lipo2 A T 19: 33,745,751 S213T probably benign Het
Lrsam1 A T 2: 32,926,792 I723N probably damaging Het
Man2b2 G A 5: 36,815,521 R550W probably damaging Het
Map4k5 A T 12: 69,841,984 L224* probably null Het
Mast3 A G 8: 70,780,366 S1101P probably damaging Het
Mertk A G 2: 128,801,305 S875G probably benign Het
Mmel1 A G 4: 154,887,897 M302V probably benign Het
Mrgpra3 T A 7: 47,589,968 H70L possibly damaging Het
Myh3 T A 11: 67,089,010 S592T probably benign Het
Nbeal2 T C 9: 110,636,315 I451V possibly damaging Het
Nup155 T A 15: 8,128,526 V489D possibly damaging Het
Obscn T A 11: 59,022,333 T6300S probably benign Het
Olfr1294 G T 2: 111,537,452 T279K probably damaging Het
Olfr1377 T A 11: 50,985,083 C127* probably null Het
Olfr290 A C 7: 84,916,426 I216L possibly damaging Het
Olfr350 A G 2: 36,850,876 M277V probably benign Het
Oprm1 A G 10: 6,829,036 I146V probably damaging Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pik3ca T C 3: 32,437,982 V243A probably benign Het
Pla2g12b G A 10: 59,416,514 probably null Het
Plekha8 A G 6: 54,624,561 D321G probably damaging Het
Pprc1 T C 19: 46,071,356 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rbms3 C T 9: 116,944,373 probably benign Het
Rictor T A 15: 6,791,680 V1495D probably benign Het
Rpl31-ps21 T C 5: 21,119,509 noncoding transcript Het
Ryr3 A T 2: 112,652,745 I4219N probably damaging Het
Sbf2 G A 7: 110,377,939 probably benign Het
Scn10a C T 9: 119,638,672 A801T probably damaging Het
Scn9a T A 2: 66,483,749 Y1866F possibly damaging Het
Sec1 A C 7: 45,679,303 Y107D probably damaging Het
Sema6d C T 2: 124,662,294 T619M possibly damaging Het
Sh2b3 C A 5: 121,828,555 probably benign Het
Slc2a4 A G 11: 69,946,587 V44A probably damaging Het
Slc5a12 T C 2: 110,621,740 I326T possibly damaging Het
Smarca5 T C 8: 80,708,680 probably null Het
Smarcd2 A G 11: 106,266,531 probably null Het
Snrpa1 A T 7: 66,069,573 probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Stard9 T G 2: 120,695,941 V893G possibly damaging Het
Stx8 T G 11: 67,973,273 V53G possibly damaging Het
Sv2c A T 13: 95,985,949 W440R probably damaging Het
Tmem181a A T 17: 6,280,665 I67F probably benign Het
Tmprss7 C T 16: 45,663,316 C565Y probably damaging Het
Trafd1 A T 5: 121,378,498 L109H probably damaging Het
Trpv4 A G 5: 114,630,022 I422T possibly damaging Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Vmn1r236 A T 17: 21,286,940 N107Y probably damaging Het
Vmn2r13 A T 5: 109,174,072 I253K probably damaging Het
Vmn2r2 T A 3: 64,134,539 I252F probably damaging Het
Vsig8 A G 1: 172,559,638 D27G probably damaging Het
Wdr92 T A 11: 17,227,165 N174K probably damaging Het
Wiz A T 17: 32,356,437 Y908* probably null Het
Wnk1 A T 6: 119,962,438 S1113T probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp691 G T 4: 119,170,567 T156K probably damaging Het
Zfp791 A T 8: 85,110,406 D276E probably benign Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 unclassified probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAAACCAAGAAGTCACTGTCTC -3'
(R):5'- TGAACTCACCGAGGACAAAG -3'

Sequencing Primer
(F):5'- AAGAAGTCACTGTCTCAGCTG -3'
(R):5'- CACCGAGGACAAAGTATATGTCTTC -3'
Posted On2016-03-01