Mutagenetix > Incidental Mutation

Incidental Mutation 'R4822:Adamts19'

371258

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

042438-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4822 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58890284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 250 (I250M)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: I250M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: I250M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.3334

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	C	T	14: 70,156,458	V243I	probably benign	Het
Acadvl	C	T	11: 70,011,184	G485S	probably benign	Het
Acap3	T	A	4: 155,902,451		probably benign	Het
AF067061	A	T	13: 120,264,150	T117S	probably damaging	Het
Amacr	T	A	15: 10,983,410	I102N	probably damaging	Het
Apob	A	G	12: 8,015,741	T4237A	probably benign	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Bicd1	A	T	6: 149,519,254		probably benign	Het
Caskin2	T	A	11: 115,807,299	E49V	probably damaging	Het
Cemip	T	A	7: 83,973,241	I577F	probably benign	Het
Chrnb1	T	C	11: 69,795,675	S40G	possibly damaging	Het
Ctif	C	T	18: 75,521,561	C298Y	probably benign	Het
Cul9	A	C	17: 46,530,051	H764Q	probably benign	Het
Cwf19l2	T	A	9: 3,458,839	C763S	probably damaging	Het
Dhx57	A	T	17: 80,242,167		probably null	Het
Dnhd1	G	A	7: 105,703,964	D2775N	probably benign	Het
Enpp1	A	T	10: 24,661,935	M384K	possibly damaging	Het
Fat2	T	C	11: 55,311,318	N310S	probably benign	Het
Fbxw7	A	T	3: 84,967,507	Y232F	possibly damaging	Het
Fcamr	T	A	1: 130,812,686	S281T	possibly damaging	Het
Gm10762	C	T	2: 128,967,186	W81*	probably null	Het
Gm5592	A	G	7: 41,155,890		probably benign	Het
Gm5745	T	C	9: 73,175,698		noncoding transcript	Het
Gm6185	G	C	1: 161,213,254		noncoding transcript	Het
Hid1	T	A	11: 115,355,299	N382Y	probably damaging	Het
Hoxa10	A	T	6: 52,232,589	F68I	probably damaging	Het
Ift88	T	A	14: 57,441,869		probably null	Het
Ighg2b	A	T	12: 113,306,391	*336R	probably null	Het
Ighv7-2	A	C	12: 113,912,272	L37R	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnn3	G	C	3: 89,667,289	V703L	possibly damaging	Het
Kiz	C	A	2: 146,891,069	S388R	probably damaging	Het
Klhl20	G	A	1: 161,093,763	Q41*	probably null	Het
Krt31	T	C	11: 100,047,784	I328V	possibly damaging	Het
Lama4	A	T	10: 39,033,053	I330L	probably benign	Het
Lipo2	A	T	19: 33,745,751	S213T	probably benign	Het
Lrsam1	A	T	2: 32,926,792	I723N	probably damaging	Het
Man2b2	G	A	5: 36,815,521	R550W	probably damaging	Het
Map4k5	A	T	12: 69,841,984	L224*	probably null	Het
Mast3	A	G	8: 70,780,366	S1101P	probably damaging	Het
Mertk	A	G	2: 128,801,305	S875G	probably benign	Het
Mmel1	A	G	4: 154,887,897	M302V	probably benign	Het
Mrgpra3	T	A	7: 47,589,968	H70L	possibly damaging	Het
Myh3	T	A	11: 67,089,010	S592T	probably benign	Het
Nbeal2	T	C	9: 110,636,315	I451V	possibly damaging	Het
Nup155	T	A	15: 8,128,526	V489D	possibly damaging	Het
Obscn	T	A	11: 59,022,333	T6300S	probably benign	Het
Olfr1294	G	T	2: 111,537,452	T279K	probably damaging	Het
Olfr1377	T	A	11: 50,985,083	C127*	probably null	Het
Olfr290	A	C	7: 84,916,426	I216L	possibly damaging	Het
Olfr350	A	G	2: 36,850,876	M277V	probably benign	Het
Oprm1	A	G	10: 6,829,036	I146V	probably damaging	Het
Otub1	A	T	19: 7,204,429	D27E	probably damaging	Het
Pik3ca	T	C	3: 32,437,982	V243A	probably benign	Het
Pla2g12b	G	A	10: 59,416,514		probably null	Het
Plekha8	A	G	6: 54,624,561	D321G	probably damaging	Het
Pprc1	T	C	19: 46,071,356		probably benign	Het
Prkdc	A	G	16: 15,650,712	D129G	possibly damaging	Het
Rbms3	C	T	9: 116,944,373		probably benign	Het
Rictor	T	A	15: 6,791,680	V1495D	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,509		noncoding transcript	Het
Ryr3	A	T	2: 112,652,745	I4219N	probably damaging	Het
Sbf2	G	A	7: 110,377,939		probably benign	Het
Scn10a	C	T	9: 119,638,672	A801T	probably damaging	Het
Scn9a	T	A	2: 66,483,749	Y1866F	possibly damaging	Het
Sec1	A	C	7: 45,679,303	Y107D	probably damaging	Het
Sema6d	C	T	2: 124,662,294	T619M	possibly damaging	Het
Sh2b3	C	A	5: 121,828,555		probably benign	Het
Slc2a4	A	G	11: 69,946,587	V44A	probably damaging	Het
Slc5a12	T	C	2: 110,621,740	I326T	possibly damaging	Het
Smarca5	T	C	8: 80,708,680		probably null	Het
Smarcd2	A	G	11: 106,266,531		probably null	Het
Snrpa1	A	T	7: 66,069,573		probably benign	Het
Sptbn5	T	G	2: 120,067,968	K470Q	probably benign	Het
Stard9	T	G	2: 120,695,941	V893G	possibly damaging	Het
Stx8	T	G	11: 67,973,273	V53G	possibly damaging	Het
Sv2c	A	T	13: 95,985,949	W440R	probably damaging	Het
Tmem181a	A	T	17: 6,280,665	I67F	probably benign	Het
Tmprss7	C	T	16: 45,663,316	C565Y	probably damaging	Het
Trafd1	A	T	5: 121,378,498	L109H	probably damaging	Het
Trpv4	A	G	5: 114,630,022	I422T	possibly damaging	Het
Usp24	T	A	4: 106,416,047	Y2210N	probably damaging	Het
Vmn1r236	A	T	17: 21,286,940	N107Y	probably damaging	Het
Vmn2r13	A	T	5: 109,174,072	I253K	probably damaging	Het
Vmn2r2	T	A	3: 64,134,539	I252F	probably damaging	Het
Vsig8	A	G	1: 172,559,638	D27G	probably damaging	Het
Wdr92	T	A	11: 17,227,165	N174K	probably damaging	Het
Wiz	A	T	17: 32,356,437	Y908*	probably null	Het
Wnk1	A	T	6: 119,962,438	S1113T	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp691	G	T	4: 119,170,567	T156K	probably damaging	Het
Zfp791	A	T	8: 85,110,406	D276E	probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ACTATGAGAAGGTGGCTGGC -3'
(R):5'- CGGAGACAGTGTTTCTAAGAATTCAC -3'

Sequencing Primer
(F):5'- CTTCCTAGTGGGGCTGCAAAAATAG -3'
(R):5'- CACACAGAGTTAAATTGTCTCAGG -3'

Posted On

2016-03-01