Incidental Mutation 'R4823:Olfr1176'
ID371265
Institutional Source Beutler Lab
Gene Symbol Olfr1176
Ensembl Gene ENSMUSG00000050023
Gene Nameolfactory receptor 1176
SynonymsMOR174-5, GA_x6K02T2Q125-49824309-49825256
MMRRC Submission 042439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4823 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88336721-88342048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88339835 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000149943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057439] [ENSMUST00000137895] [ENSMUST00000213778] [ENSMUST00000216713]
Predicted Effect probably damaging
Transcript: ENSMUST00000057439
AA Change: D90G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053353
Gene: ENSMUSG00000050023
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:7tm_4 32 309 5.3e-46 PFAM
Pfam:7tm_1 42 291 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137895
Predicted Effect probably damaging
Transcript: ENSMUST00000213778
AA Change: D90G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000216713
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Olfr1176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Olfr1176 APN 2 88340427 missense probably damaging 1.00
IGL02166:Olfr1176 APN 2 88339678 missense probably damaging 0.97
IGL02340:Olfr1176 APN 2 88339562 unclassified probably benign
IGL02598:Olfr1176 APN 2 88340251 missense possibly damaging 0.64
IGL03069:Olfr1176 APN 2 88340299 splice site probably null
IGL03212:Olfr1176 APN 2 88339672 missense probably damaging 1.00
R1959:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R1960:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R2907:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R2908:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R4049:Olfr1176 UTSW 2 88343800 splice site probably null
R4257:Olfr1176 UTSW 2 88340277 missense probably damaging 1.00
R4897:Olfr1176 UTSW 2 88344342 missense possibly damaging 0.89
R5106:Olfr1176 UTSW 2 88340110 missense probably benign 0.07
R5192:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5196:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5331:Olfr1176 UTSW 2 88339988 missense probably damaging 1.00
R5579:Olfr1176 UTSW 2 88340413 missense possibly damaging 0.83
R6283:Olfr1176 UTSW 2 88339658 missense probably benign 0.33
R6702:Olfr1176 UTSW 2 88340242 missense probably benign 0.02
R8155:Olfr1176 UTSW 2 88339952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGGATTCTCAGAGTATCCGAAC -3'
(R):5'- TTCCAGTTACTAGGAGAGCACAG -3'

Sequencing Primer
(F):5'- CTCAGAGTATCCGAACTTACAGGTG -3'
(R):5'- GAGCTTCTGAGACATAGCCACTG -3'
Posted On2016-03-01