Incidental Mutation 'R4823:Hps3'
ID371267
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene NameHPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonymscoa, cocoa
MMRRC Submission 042439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4823 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19995945-20035315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20012726 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 559 (Y559H)
Ref Sequence ENSEMBL: ENSMUSP00000103957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000012580] [ENSMUST00000108321]
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012580
AA Change: Y691H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: Y691H

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108321
AA Change: Y559H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: Y559H

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155121
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20019807 missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20025792 missense probably benign 0.00
IGL01320:Hps3 APN 3 20030469 missense probably benign 0.12
IGL01364:Hps3 APN 3 20003305 missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20010966 missense probably damaging 1.00
IGL01843:Hps3 APN 3 20029001 missense probably benign 0.05
IGL02294:Hps3 APN 3 20014048 missense probably damaging 1.00
IGL02581:Hps3 APN 3 20003221 intron probably benign
Blue UTSW 3 20030796 missense probably damaging 1.00
earl_grey UTSW 3 20017173 intron probably benign
gandalf UTSW 3 20012796 nonsense probably null
pam_gray UTSW 3 20017173 intron probably benign
R0107:Hps3 UTSW 3 20030796 missense probably damaging 1.00
R0245:Hps3 UTSW 3 20012796 nonsense probably null
R0421:Hps3 UTSW 3 20029316 missense probably benign 0.00
R0524:Hps3 UTSW 3 20012776 missense probably damaging 1.00
R0763:Hps3 UTSW 3 20003279 missense probably damaging 1.00
R1795:Hps3 UTSW 3 20012695 critical splice donor site probably null
R1864:Hps3 UTSW 3 20019959 critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20030527 missense probably benign 0.01
R2101:Hps3 UTSW 3 20012783 missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20002363 missense probably benign
R2268:Hps3 UTSW 3 20012935 splice site probably benign
R2520:Hps3 UTSW 3 20029030 missense probably damaging 1.00
R3809:Hps3 UTSW 3 20018812 missense probably damaging 1.00
R3888:Hps3 UTSW 3 20003223 critical splice donor site probably null
R3942:Hps3 UTSW 3 19996939 missense probably damaging 1.00
R4022:Hps3 UTSW 3 20035261 missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20029229 missense probably damaging 1.00
R4739:Hps3 UTSW 3 20030410 critical splice acceptor site probably null
R4912:Hps3 UTSW 3 20014173 missense probably damaging 1.00
R5307:Hps3 UTSW 3 20012701 missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20008870 missense probably benign 0.02
R6140:Hps3 UTSW 3 19996987 missense probably damaging 1.00
R6183:Hps3 UTSW 3 20008868 missense probably benign 0.04
R6971:Hps3 UTSW 3 20011535 missense probably damaging 1.00
R6981:Hps3 UTSW 3 20022820 missense probably damaging 1.00
R7120:Hps3 UTSW 3 20011541 missense probably damaging 1.00
R7146:Hps3 UTSW 3 20008886 missense probably damaging 1.00
R7223:Hps3 UTSW 3 20030419 missense probably benign 0.05
R7448:Hps3 UTSW 3 20035165 missense probably damaging 0.99
R7452:Hps3 UTSW 3 20011428 missense probably damaging 1.00
R7560:Hps3 UTSW 3 20030452 missense probably benign 0.29
R7659:Hps3 UTSW 3 20022814 nonsense probably null
R7769:Hps3 UTSW 3 20018808 splice site probably null
R8050:Hps3 UTSW 3 20003328 missense probably benign
R8242:Hps3 UTSW 3 20014126 missense possibly damaging 0.59
X0021:Hps3 UTSW 3 20030749 missense probably benign 0.14
X0066:Hps3 UTSW 3 20015988 missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20008901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTACAGTGATGATGAAAGATC -3'
(R):5'- AGCAAAAGTGGCTCAGATATTCC -3'

Sequencing Primer
(F):5'- TTCCATTTGACAGATCTAAAGTTCC -3'
(R):5'- GCTCAGATATTCCACATGGCTGAG -3'
Posted On2016-03-01