Incidental Mutation 'R0422:Panx1'
ID37128
Institutional Source Beutler Lab
Gene Symbol Panx1
Ensembl Gene ENSMUSG00000031934
Gene Namepannexin 1
Synonyms
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0422 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15002128-15045478 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 15007816 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 249 (S249*)
Ref Sequence ENSEMBL: ENSMUSP00000126405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056755] [ENSMUST00000164273] [ENSMUST00000169288]
Predicted Effect probably benign
Transcript: ENSMUST00000056755
SMART Domains Protein: ENSMUSP00000053557
Gene: ENSMUSG00000031934

DomainStartEndE-ValueType
Pfam:Innexin 31 102 1.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164273
AA Change: S249*
SMART Domains Protein: ENSMUSP00000126405
Gene: ENSMUSG00000031934
AA Change: S249*

DomainStartEndE-ValueType
Pfam:Innexin 33 256 2.1e-16 PFAM
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166933
Predicted Effect probably benign
Transcript: ENSMUST00000169288
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage recruitment, YO-PRO-1 dye uptake, ATP release by apoptotic thymocytes, hippocampal neurons, and astrocytes. Mice homozygous for a different knock-out allele exhibit protection from I/R-induced retinal ganglion cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Panx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Panx1 APN 9 15007844 missense probably damaging 0.97
IGL01364:Panx1 APN 9 15021465 missense probably damaging 1.00
IGL02831:Panx1 APN 9 15007648 missense probably damaging 1.00
IGL02861:Panx1 APN 9 15007805 missense probably benign
cathedral UTSW 9 15007633 missense possibly damaging 0.53
elephant UTSW 9 15010217 missense probably damaging 1.00
notre_dame UTSW 9 15010217 missense probably damaging 1.00
R0602:Panx1 UTSW 9 15010204 missense probably damaging 1.00
R1509:Panx1 UTSW 9 15010045 missense possibly damaging 0.53
R1681:Panx1 UTSW 9 15007783 missense probably benign 0.13
R1862:Panx1 UTSW 9 15007428 missense probably damaging 1.00
R1895:Panx1 UTSW 9 15007526 missense probably benign 0.13
R1937:Panx1 UTSW 9 15007684 missense possibly damaging 0.68
R1946:Panx1 UTSW 9 15007526 missense probably benign 0.13
R2447:Panx1 UTSW 9 15044889 missense probably damaging 0.99
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3733:Panx1 UTSW 9 15006171 unclassified probably benign
R3734:Panx1 UTSW 9 15006171 unclassified probably benign
R3958:Panx1 UTSW 9 15006171 unclassified probably benign
R3960:Panx1 UTSW 9 15006171 unclassified probably benign
R4744:Panx1 UTSW 9 15010298 intron probably benign
R4990:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R5272:Panx1 UTSW 9 15044856 critical splice donor site probably null
R5556:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R5935:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R6126:Panx1 UTSW 9 15007790 missense probably benign 0.38
R6683:Panx1 UTSW 9 15008011 missense probably benign 0.41
R6743:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R6873:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R8061:Panx1 UTSW 9 15045001 missense possibly damaging 0.58
Z1177:Panx1 UTSW 9 15007814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCCGGAATGGGATGAAGAAC -3'
(R):5'- CCGTGCCTTTCACACTTGATGAGAC -3'

Sequencing Primer
(F):5'- ACGTGTAGACGACCACGG -3'
(R):5'- GATATCTGAAAGCCACTTCAAGTACC -3'
Posted On2013-05-09