Mutagenetix > Incidental Mutations

Incidental Mutation 'R4823:Gtf2ird1'

371280

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird1

Ensembl Gene

ENSMUSG00000023079

Gene Name

general transcription factor II I repeat domain-containing 1

Synonyms

binding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN

MMRRC Submission

042439-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.665) question?

Stock #

R4823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134357656-134456716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 134395722 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 390 (V390A)

Ref Sequence

ENSEMBL: ENSMUSP00000143809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202280] [ENSMUST00000202554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073161
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	814	889	1.7e-34	PFAM
Pfam:GTF2I	917	992	1.7e-34	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074114
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.5e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	2.8e-34	PFAM
Pfam:GTF2I	814	889	1.6e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100650
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.2e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	787	862	1.8e-34	PFAM
Pfam:GTF2I	890	965	1.8e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100652
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.8e-29	PFAM
Pfam:GTF2I	351	425	6.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.3e-34	PFAM
Pfam:GTF2I	690	764	3.3e-32	PFAM
Pfam:GTF2I	814	888	3e-33	PFAM
Pfam:GTF2I	917	991	3e-33	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100654
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	716	791	1.5e-34	PFAM
Pfam:GTF2I	819	894	1.5e-34	PFAM
low complexity region	922	945	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111244
AA Change: V390A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.3e-29	PFAM
Pfam:GTF2I	351	425	4.9e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1.7e-34	PFAM
Pfam:GTF2I	690	764	2.5e-32	PFAM
Pfam:GTF2I	787	861	2.3e-33	PFAM
Pfam:GTF2I	890	964	2.3e-33	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111245
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.6e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	671	746	2.9e-34	PFAM
Pfam:GTF2I	768	843	1.7e-34	PFAM
Pfam:GTF2I	871	946	1.7e-34	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167084
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	690	765	2.7e-34	PFAM
Pfam:GTF2I	814	889	1.5e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171794
AA Change: V390A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.2e-29	PFAM
Pfam:GTF2I	351	426	3.8e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	8.9e-35	PFAM
Pfam:GTF2I	690	765	2.4e-34	PFAM
Pfam:GTF2I	787	862	1.4e-34	PFAM
Pfam:GTF2I	890	965	1.4e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000200798
AA Change: V25A

Predicted Effect

probably damaging
Transcript: ENSMUST00000200944
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.9e-29	PFAM
Pfam:GTF2I	351	425	5.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2e-34	PFAM
Pfam:GTF2I	690	764	2.8e-32	PFAM
Pfam:GTF2I	814	888	2.6e-33	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000201704
AA Change: V177A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202202

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202280
AA Change: V390A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	2.6e-26	PFAM
Pfam:GTF2I	351	425	2.9e-29	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1e-31	PFAM
Pfam:GTF2I	690	764	1.5e-29	PFAM
Pfam:GTF2I	787	861	1.3e-30	PFAM
low complexity region	890	913	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202554
AA Change: V390A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: V390A

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.5e-29	PFAM
Pfam:GTF2I	351	425	6.3e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.2e-34	PFAM
Pfam:GTF2I	671	745	3.2e-32	PFAM
Pfam:GTF2I	768	842	2.9e-33	PFAM
Pfam:GTF2I	871	945	2.9e-33	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000201526
AA Change: V25A

Predicted Effect

unknown
Transcript: ENSMUST00000201441
AA Change: V25A

Predicted Effect

unknown
Transcript: ENSMUST00000201447
AA Change: V25A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202335

Meta Mutation Damage Score

0.1259

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	A	5: 87,972,598	D405N	probably benign	Het
4921517D22Rik	T	G	13: 59,690,904	E38A	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,362	I152F	probably benign	Het
5830473C10Rik	T	A	5: 90,566,503	L124H	probably benign	Het
Aass	A	T	6: 23,107,691	D364E	probably benign	Het
Adamts2	A	G	11: 50,737,187	D238G	probably benign	Het
Aplf	G	A	6: 87,646,255	L302F	probably damaging	Het
Apol7b	G	T	15: 77,427,782		probably benign	Het
Arhgef12	A	G	9: 43,020,696	V165A	probably benign	Het
Ascc3	T	C	10: 50,713,233	S1017P	probably damaging	Het
B230104I21Rik	T	A	4: 154,349,747		probably benign	Het
Bfsp2	C	A	9: 103,479,883	C115F	probably damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
C87499	T	C	4: 88,629,215	K160R	probably damaging	Het
Capn5	A	T	7: 98,126,441	V431E	probably damaging	Het
Ccdc88c	A	G	12: 100,930,543	Y1390H	probably damaging	Het
Ccr3	A	G	9: 124,028,681	T18A	probably damaging	Het
Cdh5	T	C	8: 104,142,669	S676P	probably benign	Het
Ceacam5	A	G	7: 17,757,744	T680A	possibly damaging	Het
Cebpd	G	A	16: 15,888,114	G264S	probably benign	Het
Cfd	T	C	10: 79,890,948	V8A	probably benign	Het
Cops9	C	T	1: 92,641,866		probably benign	Het
Cpne6	T	C	14: 55,517,010	Y533H	probably damaging	Het
Cyp2c67	T	A	19: 39,615,724	H396L	probably benign	Het
Cyp2j9	G	A	4: 96,568,735	P500S	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,413		probably null	Het
Dbt	G	A	3: 116,523,387	D71N	probably damaging	Het
Ddx41	G	T	13: 55,532,055	Q440K	probably benign	Het
Doxl2	A	G	6: 48,975,261	D40G	probably damaging	Het
Elovl4	A	G	9: 83,780,685	F174S	probably damaging	Het
Emcn	C	G	3: 137,423,426	P193R	probably damaging	Het
Etnk1	T	C	6: 143,167,638		probably null	Het
Fads3	A	C	19: 10,041,888	S53R	probably damaging	Het
Fam193a	A	G	5: 34,459,028	E849G	probably damaging	Het
Fat3	A	G	9: 15,996,507	V2733A	probably benign	Het
Frem3	T	A	8: 80,613,958	M960K	probably benign	Het
Frmd6	A	T	12: 70,872,575	I62L	probably benign	Het
Glmp	T	C	3: 88,325,223		probably benign	Het
Gm17421	T	C	12: 113,369,541		noncoding transcript	Het
Gm27013	T	A	6: 130,522,223		noncoding transcript	Het
Hps3	A	G	3: 20,012,726	Y559H	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr3	A	G	17: 27,085,147	D114G	probably benign	Het
Jmjd4	G	A	11: 59,455,580	A408T	probably benign	Het
Kcnh4	G	T	11: 100,755,174	A316D	probably damaging	Het
Klrg1	T	A	6: 122,273,533		probably null	Het
Lancl2	T	A	6: 57,732,277	Y355N	probably damaging	Het
Ltb	T	C	17: 35,195,230	S115P	probably benign	Het
Mccc2	T	G	13: 100,000,254	R64S	probably benign	Het
Mgam2-ps	T	A	6: 40,832,662		noncoding transcript	Het
Mrrf	T	G	2: 36,148,030	N104K	possibly damaging	Het
Nipa1	C	A	7: 55,979,688	V226L	possibly damaging	Het
Numa1	T	A	7: 101,996,037	L290Q	probably damaging	Het
Ofcc1	T	A	13: 40,280,473	H52L	probably damaging	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1176	A	G	2: 88,339,835	D90G	probably damaging	Het
Olfr1444	A	T	19: 12,861,816	I14F	probably benign	Het
Olfr1505	G	A	19: 13,919,658	V213I	probably benign	Het
Olfr292	T	A	7: 86,694,588	I44N	probably damaging	Het
P2ry12	G	A	3: 59,217,897	S119L	probably benign	Het
Pde7b	T	A	10: 20,438,785	N192Y	probably damaging	Het
Pfkl	T	C	10: 77,997,594	N258S	probably damaging	Het
Phykpl	G	A	11: 51,586,593	A71T	probably damaging	Het
Ppp1r16a	T	C	15: 76,693,193		probably benign	Het
Pramef20	T	C	4: 144,373,211	N328S	possibly damaging	Het
Prune2	C	T	19: 17,120,504	T1124M	probably damaging	Het
Rapgef6	A	G	11: 54,694,500	I1570V	probably benign	Het
Rbm34	T	C	8: 126,970,905	S19G	probably benign	Het
Rnf10	T	C	5: 115,255,442		probably null	Het
Rnf34	A	G	5: 122,850,302		probably null	Het
Setd4	A	G	16: 93,589,950	S287P	probably benign	Het
Shc3	C	T	13: 51,451,570	V225I	probably benign	Het
Sipa1l3	C	T	7: 29,371,002	V1030I	probably damaging	Het
Siva1	G	T	12: 112,645,064	R33L	probably damaging	Het
Slc4a5	C	T	6: 83,272,133	T573I	probably damaging	Het
Sorcs1	C	T	19: 50,678,140	R110Q	possibly damaging	Het
Sorcs1	T	C	19: 50,230,302	I581V	possibly damaging	Het
Sorl1	T	C	9: 41,992,321	D1545G	probably damaging	Het
Tas2r124	T	G	6: 132,755,546	S273A	probably damaging	Het
Tcf15	T	C	2: 152,143,893	F90L	probably damaging	Het
Trim59	G	A	3: 69,037,120	R296C	probably benign	Het
Tulp1	A	T	17: 28,353,572	D229E	probably benign	Het
Ush1c	T	A	7: 46,195,733	N886I	probably benign	Het
Usp9y	A	T	Y: 1,444,559	S127T	probably damaging	Het
Vmn1r19	T	A	6: 57,405,234	Y257*	probably null	Het
Vmn2r109	A	T	17: 20,553,891	Y401N	probably damaging	Het
Vmn2r69	A	C	7: 85,411,300	S359A	probably benign	Het
Zfp37	A	T	4: 62,191,503	N479K	probably benign	Het

Other mutations in Gtf2ird1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gtf2ird1	APN	5	134358891	missense	probably benign	0.03
IGL02477:Gtf2ird1	APN	5	134379978	missense	probably damaging	1.00
IGL02659:Gtf2ird1	APN	5	134377041	missense	probably damaging	1.00
IGL02752:Gtf2ird1	APN	5	134358824	makesense	probably null
IGL02963:Gtf2ird1	APN	5	134389687	missense	probably benign	0.05
IGL03328:Gtf2ird1	APN	5	134389129	critical splice donor site	probably null
IGL03379:Gtf2ird1	APN	5	134382538	missense	possibly damaging	0.94
R0585:Gtf2ird1	UTSW	5	134376942	missense	probably damaging	1.00
R1199:Gtf2ird1	UTSW	5	134411064	missense	possibly damaging	0.85
R1388:Gtf2ird1	UTSW	5	134395710	missense	probably damaging	1.00
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1544:Gtf2ird1	UTSW	5	134358918	missense	possibly damaging	0.93
R1652:Gtf2ird1	UTSW	5	134395713	missense	probably damaging	1.00
R1792:Gtf2ird1	UTSW	5	134366936	splice site	probably null
R1852:Gtf2ird1	UTSW	5	134382580	splice site	probably null
R1938:Gtf2ird1	UTSW	5	134415245	missense	probably damaging	1.00
R1996:Gtf2ird1	UTSW	5	134376886	splice site	probably benign
R2020:Gtf2ird1	UTSW	5	134417093	missense	probably damaging	1.00
R2025:Gtf2ird1	UTSW	5	134363934	missense	probably damaging	1.00
R2849:Gtf2ird1	UTSW	5	134359007	missense	probably damaging	1.00
R2964:Gtf2ird1	UTSW	5	134357684	splice site	probably null
R3421:Gtf2ird1	UTSW	5	134388500	missense	probably benign	0.41
R4543:Gtf2ird1	UTSW	5	134363900	critical splice donor site	probably null
R4569:Gtf2ird1	UTSW	5	134411003	missense	probably damaging	1.00
R4664:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4665:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4666:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4680:Gtf2ird1	UTSW	5	134357881	missense	probably damaging	1.00
R4709:Gtf2ird1	UTSW	5	134404734	missense	probably benign
R4806:Gtf2ird1	UTSW	5	134383896	missense	probably damaging	0.99
R4857:Gtf2ird1	UTSW	5	134362544	missense	probably damaging	0.96
R4970:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R4974:Gtf2ird1	UTSW	5	134357831	nonsense	probably null
R4975:Gtf2ird1	UTSW	5	134395627	missense	probably damaging	1.00
R5072:Gtf2ird1	UTSW	5	134390933	splice site	probably null
R5112:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R5653:Gtf2ird1	UTSW	5	134410967	missense	probably damaging	1.00
R5681:Gtf2ird1	UTSW	5	134363318	missense	probably damaging	1.00
R5738:Gtf2ird1	UTSW	5	134383818	missense	probably damaging	1.00
R5753:Gtf2ird1	UTSW	5	134410983	missense	probably damaging	1.00
R6385:Gtf2ird1	UTSW	5	134404690	missense	probably benign	0.19
R6580:Gtf2ird1	UTSW	5	134361039	missense	probably damaging	1.00
R6787:Gtf2ird1	UTSW	5	134363912	missense	probably damaging	0.99
R6981:Gtf2ird1	UTSW	5	134383922	splice site	probably benign
R7208:Gtf2ird1	UTSW	5	134411094	missense	probably benign	0.35
R7271:Gtf2ird1	UTSW	5	134404904	missense	probably benign	0.01
R7517:Gtf2ird1	UTSW	5	134362525	missense	probably benign
R7786:Gtf2ird1	UTSW	5	134390899	nonsense	probably null
R7788:Gtf2ird1	UTSW	5	134417131	nonsense	probably null
R7850:Gtf2ird1	UTSW	5	134363215	missense	probably benign	0.21
R7866:Gtf2ird1	UTSW	5	134363209	missense	probably benign	0.01
R8183:Gtf2ird1	UTSW	5	134357835	missense	unknown
X0026:Gtf2ird1	UTSW	5	134376102	splice site	probably null
Z1176:Gtf2ird1	UTSW	5	134409312	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGCTCTAGAATCATCTGCTCCT -3'
(R):5'- CACGCAGCCAACAGTGTTA -3'

Sequencing Primer
(F):5'- TTATAGGCAAGGGCTCTACCACTG -3'
(R):5'- TTAGATGGACTGTGGCCAAC -3'

Posted On

2016-03-01