Incidental Mutation 'R4823:Aass'
ID371281
Institutional Source Beutler Lab
Gene Symbol Aass
Ensembl Gene ENSMUSG00000029695
Gene Nameaminoadipate-semialdehyde synthase
SynonymsLOR/SDH, Lorsdh
MMRRC Submission 042439-MU
Accession Numbers

NCBI RefSeq: NM_013930.4; MGI:1353573

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4823 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23072173-23132986 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23107691 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 364 (D364E)
Ref Sequence ENSEMBL: ENSMUSP00000031707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031707] [ENSMUST00000149864]
Predicted Effect probably benign
Transcript: ENSMUST00000031707
AA Change: D364E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031707
Gene: ENSMUSG00000029695
AA Change: D364E

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
AlaDh_PNT_N 27 157 2.76e-22 SMART
AlaDh_PNT_C 197 399 7.94e-23 SMART
Pfam:Sacchrp_dh_NADP 483 598 2.8e-26 PFAM
Pfam:Sacchrp_dh_C 602 916 1.2e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138063
Predicted Effect probably benign
Transcript: ENSMUST00000149864
SMART Domains Protein: ENSMUSP00000115079
Gene: ENSMUSG00000029695

DomainStartEndE-ValueType
Pfam:Saccharop_dh 73 209 8.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152280
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: This gene encodes a bifunctional mitochondrial protein that catalyzes the first two steps in the lysine degradation pathway. The N-terminus contains lysine-ketoglutarate reductase activity and converts lysine to saccharopine, whereas the C-terminus contains saccharopine dehydrogenase activity and converts saccharopine to alpha-aminoadipate semialdehyde. Mutations in a human gene encoding a highly similar protein are associated with familial hyperlysinemia. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Aass
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aass APN 6 23075852 missense probably benign 0.10
IGL01465:Aass APN 6 23114839 critical splice donor site probably null
IGL01617:Aass APN 6 23115150 missense possibly damaging 0.89
IGL01810:Aass APN 6 23107634 missense probably damaging 0.99
IGL02024:Aass APN 6 23113706 missense probably damaging 1.00
IGL02167:Aass APN 6 23122722 intron probably benign
IGL02339:Aass APN 6 23093966 missense probably damaging 0.99
IGL02720:Aass APN 6 23122703 intron probably benign
IGL02877:Aass APN 6 23078876 nonsense probably null
IGL02948:Aass APN 6 23094319 splice site probably benign
PIT4651001:Aass UTSW 6 23118751 missense probably benign 0.00
R0152:Aass UTSW 6 23074689 missense probably damaging 1.00
R0196:Aass UTSW 6 23109520 missense probably damaging 1.00
R0546:Aass UTSW 6 23077077 critical splice donor site probably null
R0841:Aass UTSW 6 23075811 missense probably benign
R0848:Aass UTSW 6 23114985 missense probably damaging 0.98
R0942:Aass UTSW 6 23075152 splice site probably benign
R1082:Aass UTSW 6 23093908 missense probably damaging 1.00
R1159:Aass UTSW 6 23115138 missense probably damaging 0.99
R1730:Aass UTSW 6 23121019 missense probably damaging 1.00
R1818:Aass UTSW 6 23075858 critical splice acceptor site probably null
R1906:Aass UTSW 6 23072985 missense probably benign 0.00
R2004:Aass UTSW 6 23092562 nonsense probably null
R2191:Aass UTSW 6 23078866 missense possibly damaging 0.91
R3690:Aass UTSW 6 23091329 missense probably benign 0.09
R3843:Aass UTSW 6 23092496 nonsense probably null
R3879:Aass UTSW 6 23122521 missense probably damaging 1.00
R4080:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4081:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4082:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4348:Aass UTSW 6 23113739 missense probably benign 0.03
R4622:Aass UTSW 6 23092330 missense probably damaging 1.00
R4701:Aass UTSW 6 23075856 nonsense probably null
R5108:Aass UTSW 6 23094208 missense probably damaging 0.99
R5248:Aass UTSW 6 23109438 missense probably benign 0.08
R5481:Aass UTSW 6 23113476 missense probably benign 0.00
R5776:Aass UTSW 6 23107650 missense possibly damaging 0.66
R5883:Aass UTSW 6 23072994 missense probably benign 0.04
R6356:Aass UTSW 6 23093902 missense probably damaging 1.00
R6594:Aass UTSW 6 23113433 missense probably benign 0.00
R6784:Aass UTSW 6 23093896 missense probably null 1.00
R6855:Aass UTSW 6 23114845 missense probably damaging 0.97
R7184:Aass UTSW 6 23094220 missense possibly damaging 0.55
R7208:Aass UTSW 6 23074630 missense probably damaging 0.99
R7464:Aass UTSW 6 23077153 missense possibly damaging 0.69
R7750:Aass UTSW 6 23075200 missense possibly damaging 0.58
R7821:Aass UTSW 6 23120930 missense probably damaging 1.00
R8262:Aass UTSW 6 23107710 missense possibly damaging 0.94
R8303:Aass UTSW 6 23092368 missense probably benign 0.03
R8430:Aass UTSW 6 23078982 missense probably benign 0.01
Z1176:Aass UTSW 6 23078857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTAAGCATATACCTCCAAGC -3'
(R):5'- TGTCTTAGGTCAACACACTGTCC -3'

Sequencing Primer
(F):5'- TTAAGCATATACCTCCAAGCTTTCAC -3'
(R):5'- CACTGTCCCAAAGATTGAACTGTAG -3'
Posted On2016-03-01