Incidental Mutation 'R4823:Doxl2'
ID371283
Institutional Source Beutler Lab
Gene Symbol Doxl2
Ensembl Gene ENSMUSG00000068536
Gene Namediamine oxidase-like protein 2
Synonyms
MMRRC Submission 042439-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4823 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48974963-48978746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48975261 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 40 (D40G)
Ref Sequence ENSEMBL: ENSMUSP00000087517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090063] [ENSMUST00000184917]
Predicted Effect probably damaging
Transcript: ENSMUST00000090063
AA Change: D40G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087517
Gene: ENSMUSG00000068536
AA Change: D40G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.5e-16 PFAM
Pfam:Cu_amine_oxid 298 708 1.3e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184852
SMART Domains Protein: ENSMUSP00000139236
Gene: ENSMUSG00000068536

DomainStartEndE-ValueType
Pfam:Cu_amine_oxid 15 212 2.4e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184917
AA Change: D40G

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139012
Gene: ENSMUSG00000068536
AA Change: D40G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.1e-21 PFAM
Pfam:Cu_amine_oxidN3 146 246 3.1e-14 PFAM
Pfam:Cu_amine_oxid 298 711 1.4e-96 PFAM
Meta Mutation Damage Score 0.6776 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Doxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Doxl2 APN 6 48978131 missense possibly damaging 0.82
IGL00985:Doxl2 APN 6 48977547 missense probably benign
IGL01556:Doxl2 APN 6 48975684 missense possibly damaging 0.58
IGL02083:Doxl2 APN 6 48976260 missense probably damaging 1.00
IGL02135:Doxl2 APN 6 48975564 missense probably benign 0.11
IGL02744:Doxl2 APN 6 48975315 missense probably benign 0.15
IGL03005:Doxl2 APN 6 48976546 nonsense probably null
R0306:Doxl2 UTSW 6 48976086 missense probably damaging 1.00
R0380:Doxl2 UTSW 6 48975839 missense probably benign
R0598:Doxl2 UTSW 6 48975537 missense probably benign 0.36
R0948:Doxl2 UTSW 6 48976344 missense probably damaging 1.00
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1432:Doxl2 UTSW 6 48975654 missense probably damaging 1.00
R1443:Doxl2 UTSW 6 48975915 missense probably damaging 1.00
R1535:Doxl2 UTSW 6 48975464 missense probably damaging 0.98
R1625:Doxl2 UTSW 6 48975171 missense probably damaging 1.00
R1872:Doxl2 UTSW 6 48975620 missense probably benign 0.00
R1960:Doxl2 UTSW 6 48975753 missense probably damaging 1.00
R2031:Doxl2 UTSW 6 48975855 missense probably damaging 0.99
R2049:Doxl2 UTSW 6 48977755 nonsense probably null
R2086:Doxl2 UTSW 6 48977602 missense probably damaging 1.00
R2144:Doxl2 UTSW 6 48975291 missense probably benign 0.00
R2145:Doxl2 UTSW 6 48976695 missense probably damaging 1.00
R2152:Doxl2 UTSW 6 48976539 missense probably damaging 1.00
R2255:Doxl2 UTSW 6 48975957 missense possibly damaging 0.75
R2973:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R2974:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R3125:Doxl2 UTSW 6 48975371 missense probably damaging 1.00
R4321:Doxl2 UTSW 6 48976522 missense probably damaging 1.00
R4367:Doxl2 UTSW 6 48976130 missense probably damaging 1.00
R4532:Doxl2 UTSW 6 48978167 missense possibly damaging 0.77
R4575:Doxl2 UTSW 6 48977568 nonsense probably null
R4611:Doxl2 UTSW 6 48975156 missense probably benign 0.39
R5320:Doxl2 UTSW 6 48975540 missense probably damaging 1.00
R5520:Doxl2 UTSW 6 48975794 missense possibly damaging 0.93
R5698:Doxl2 UTSW 6 48976322 missense possibly damaging 0.94
R5765:Doxl2 UTSW 6 48978537 missense probably damaging 1.00
R6024:Doxl2 UTSW 6 48976096 missense possibly damaging 0.71
R6061:Doxl2 UTSW 6 48976601 missense probably benign 0.02
R6268:Doxl2 UTSW 6 48977682 missense probably benign 0.01
R6564:Doxl2 UTSW 6 48977575 missense probably benign 0.00
R6640:Doxl2 UTSW 6 48977671 missense probably benign 0.21
R7131:Doxl2 UTSW 6 48976372 nonsense probably null
X0013:Doxl2 UTSW 6 48977613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGACTTAGAGACAAGGTGCTC -3'
(R):5'- AATGATGACACGGGCTTCCC -3'

Sequencing Primer
(F):5'- CTTGAGTGCTGGCTTGGAGAC -3'
(R):5'- TTCCCGCACAGGAGGTC -3'
Posted On2016-03-01