Mutagenetix > Incidental Mutation

Incidental Mutation 'R4823:Slc4a5'

371287

Institutional Source

Beutler Lab

Gene Symbol

Slc4a5

Ensembl Gene

ENSMUSG00000068323

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 5

Synonyms

C330016K18Rik

MMRRC Submission

042439-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R4823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83219828-83304945 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83272133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 573 (T573I)

Ref Sequence

ENSEMBL: ENSMUSP00000109533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]

AlphaFold

E9Q3M5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039212
AA Change: T458I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: T458I

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	5.2e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	1.1e-242	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113899
AA Change: T458I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: T458I

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	2.9e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	5.3e-243	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113900
AA Change: T573I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: T573I

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	140	407	3.4e-106	PFAM
low complexity region	436	465	N/A	INTRINSIC
Pfam:HCO3_cotransp	480	999	1.6e-224	PFAM
transmembrane domain	1006	1028	N/A	INTRINSIC
low complexity region	1051	1066	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	A	5: 87,972,598	D405N	probably benign	Het
4921517D22Rik	T	G	13: 59,690,904	E38A	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,362	I152F	probably benign	Het
5830473C10Rik	T	A	5: 90,566,503	L124H	probably benign	Het
Aass	A	T	6: 23,107,691	D364E	probably benign	Het
Adamts2	A	G	11: 50,737,187	D238G	probably benign	Het
Aplf	G	A	6: 87,646,255	L302F	probably damaging	Het
Apol7b	G	T	15: 77,427,782		probably benign	Het
Arhgef12	A	G	9: 43,020,696	V165A	probably benign	Het
Ascc3	T	C	10: 50,713,233	S1017P	probably damaging	Het
B230104I21Rik	T	A	4: 154,349,747		probably benign	Het
Bfsp2	C	A	9: 103,479,883	C115F	probably damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
C87499	T	C	4: 88,629,215	K160R	probably damaging	Het
Capn5	A	T	7: 98,126,441	V431E	probably damaging	Het
Ccdc88c	A	G	12: 100,930,543	Y1390H	probably damaging	Het
Ccr3	A	G	9: 124,028,681	T18A	probably damaging	Het
Cdh5	T	C	8: 104,142,669	S676P	probably benign	Het
Ceacam5	A	G	7: 17,757,744	T680A	possibly damaging	Het
Cebpd	G	A	16: 15,888,114	G264S	probably benign	Het
Cfd	T	C	10: 79,890,948	V8A	probably benign	Het
Cops9	C	T	1: 92,641,866		probably benign	Het
Cpne6	T	C	14: 55,517,010	Y533H	probably damaging	Het
Cyp2c67	T	A	19: 39,615,724	H396L	probably benign	Het
Cyp2j9	G	A	4: 96,568,735	P500S	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,413		probably null	Het
Dbt	G	A	3: 116,523,387	D71N	probably damaging	Het
Ddx41	G	T	13: 55,532,055	Q440K	probably benign	Het
Doxl2	A	G	6: 48,975,261	D40G	probably damaging	Het
Elovl4	A	G	9: 83,780,685	F174S	probably damaging	Het
Emcn	C	G	3: 137,423,426	P193R	probably damaging	Het
Etnk1	T	C	6: 143,167,638		probably null	Het
Fads3	A	C	19: 10,041,888	S53R	probably damaging	Het
Fam193a	A	G	5: 34,459,028	E849G	probably damaging	Het
Fat3	A	G	9: 15,996,507	V2733A	probably benign	Het
Frem3	T	A	8: 80,613,958	M960K	probably benign	Het
Frmd6	A	T	12: 70,872,575	I62L	probably benign	Het
Glmp	T	C	3: 88,325,223		probably benign	Het
Gm17421	T	C	12: 113,369,541		noncoding transcript	Het
Gm27013	T	A	6: 130,522,223		noncoding transcript	Het
Gtf2ird1	A	G	5: 134,395,722	V390A	probably damaging	Het
Hps3	A	G	3: 20,012,726	Y559H	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr3	A	G	17: 27,085,147	D114G	probably benign	Het
Jmjd4	G	A	11: 59,455,580	A408T	probably benign	Het
Kcnh4	G	T	11: 100,755,174	A316D	probably damaging	Het
Klrg1	T	A	6: 122,273,533		probably null	Het
Lancl2	T	A	6: 57,732,277	Y355N	probably damaging	Het
Ltb	T	C	17: 35,195,230	S115P	probably benign	Het
Mccc2	T	G	13: 100,000,254	R64S	probably benign	Het
Mgam2-ps	T	A	6: 40,832,662		noncoding transcript	Het
Mrrf	T	G	2: 36,148,030	N104K	possibly damaging	Het
Nipa1	C	A	7: 55,979,688	V226L	possibly damaging	Het
Numa1	T	A	7: 101,996,037	L290Q	probably damaging	Het
Ofcc1	T	A	13: 40,280,473	H52L	probably damaging	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1176	A	G	2: 88,339,835	D90G	probably damaging	Het
Olfr1444	A	T	19: 12,861,816	I14F	probably benign	Het
Olfr1505	G	A	19: 13,919,658	V213I	probably benign	Het
Olfr292	T	A	7: 86,694,588	I44N	probably damaging	Het
P2ry12	G	A	3: 59,217,897	S119L	probably benign	Het
Pde7b	T	A	10: 20,438,785	N192Y	probably damaging	Het
Pfkl	T	C	10: 77,997,594	N258S	probably damaging	Het
Phykpl	G	A	11: 51,586,593	A71T	probably damaging	Het
Ppp1r16a	T	C	15: 76,693,193		probably benign	Het
Pramef20	T	C	4: 144,373,211	N328S	possibly damaging	Het
Prune2	C	T	19: 17,120,504	T1124M	probably damaging	Het
Rapgef6	A	G	11: 54,694,500	I1570V	probably benign	Het
Rbm34	T	C	8: 126,970,905	S19G	probably benign	Het
Rnf10	T	C	5: 115,255,442		probably null	Het
Rnf34	A	G	5: 122,850,302		probably null	Het
Setd4	A	G	16: 93,589,950	S287P	probably benign	Het
Shc3	C	T	13: 51,451,570	V225I	probably benign	Het
Sipa1l3	C	T	7: 29,371,002	V1030I	probably damaging	Het
Siva1	G	T	12: 112,645,064	R33L	probably damaging	Het
Sorcs1	C	T	19: 50,678,140	R110Q	possibly damaging	Het
Sorcs1	T	C	19: 50,230,302	I581V	possibly damaging	Het
Sorl1	T	C	9: 41,992,321	D1545G	probably damaging	Het
Tas2r124	T	G	6: 132,755,546	S273A	probably damaging	Het
Tcf15	T	C	2: 152,143,893	F90L	probably damaging	Het
Trim59	G	A	3: 69,037,120	R296C	probably benign	Het
Tulp1	A	T	17: 28,353,572	D229E	probably benign	Het
Ush1c	T	A	7: 46,195,733	N886I	probably benign	Het
Usp9y	A	T	Y: 1,444,559	S127T	probably damaging	Het
Vmn1r19	T	A	6: 57,405,234	Y257*	probably null	Het
Vmn2r109	A	T	17: 20,553,891	Y401N	probably damaging	Het
Vmn2r69	A	C	7: 85,411,300	S359A	probably benign	Het
Zfp37	A	T	4: 62,191,503	N479K	probably benign	Het

Other mutations in Slc4a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Slc4a5	APN	6	83285899	missense	probably damaging	1.00
IGL00473:Slc4a5	APN	6	83296597	missense	probably damaging	1.00
IGL00861:Slc4a5	APN	6	83299471	missense	probably benign
IGL01025:Slc4a5	APN	6	83262533	missense	probably damaging	0.98
IGL01532:Slc4a5	APN	6	83273040	splice site	probably null
IGL01991:Slc4a5	APN	6	83263543	missense	possibly damaging	0.94
IGL02271:Slc4a5	APN	6	83271103	splice site	probably benign
IGL02565:Slc4a5	APN	6	83299505	missense	probably benign	0.00
IGL02669:Slc4a5	APN	6	83263543	missense	possibly damaging	0.79
IGL02994:Slc4a5	APN	6	83272124	missense	probably damaging	1.00
IGL03259:Slc4a5	APN	6	83270997	missense	probably damaging	1.00
IGL03264:Slc4a5	APN	6	83261525	missense	probably damaging	1.00
R0032:Slc4a5	UTSW	6	83273157	missense	probably damaging	1.00
R0091:Slc4a5	UTSW	6	83277555	missense	probably benign	0.00
R0281:Slc4a5	UTSW	6	83267567	splice site	probably benign
R0366:Slc4a5	UTSW	6	83295872	missense	probably benign	0.02
R0668:Slc4a5	UTSW	6	83271072	missense	probably damaging	1.00
R1222:Slc4a5	UTSW	6	83280132	missense	probably damaging	1.00
R1550:Slc4a5	UTSW	6	83271057	missense	probably damaging	1.00
R1585:Slc4a5	UTSW	6	83265687	missense	probably damaging	1.00
R1731:Slc4a5	UTSW	6	83296635	missense	probably damaging	1.00
R1987:Slc4a5	UTSW	6	83273232	missense	possibly damaging	0.95
R2103:Slc4a5	UTSW	6	83224681	missense	probably benign	0.00
R2103:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2104:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2176:Slc4a5	UTSW	6	83262560	missense	probably damaging	0.98
R2920:Slc4a5	UTSW	6	83264387	missense	probably damaging	1.00
R2964:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2965:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2966:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R3755:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R3756:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R4293:Slc4a5	UTSW	6	83260529	missense	probably damaging	1.00
R4789:Slc4a5	UTSW	6	83270969	missense	probably benign	0.05
R4854:Slc4a5	UTSW	6	83271017	missense	probably benign	0.00
R5461:Slc4a5	UTSW	6	83285854	missense	probably benign	0.29
R5707:Slc4a5	UTSW	6	83261415	missense	probably benign	0.11
R5747:Slc4a5	UTSW	6	83271029	missense	probably damaging	1.00
R5978:Slc4a5	UTSW	6	83277536	missense	probably benign	0.01
R6126:Slc4a5	UTSW	6	83226265	missense	probably benign	0.05
R6330:Slc4a5	UTSW	6	83226374	missense	probably benign
R6564:Slc4a5	UTSW	6	83280060	missense	possibly damaging	0.71
R6786:Slc4a5	UTSW	6	83296747	critical splice donor site	probably null
R7443:Slc4a5	UTSW	6	83264315	missense	probably benign	0.45
R7672:Slc4a5	UTSW	6	83260535	missense	probably damaging	1.00
R7690:Slc4a5	UTSW	6	83285872	missense	probably damaging	1.00
R7837:Slc4a5	UTSW	6	83261557	missense	probably benign	0.01
R8169:Slc4a5	UTSW	6	83303391	missense	probably benign	0.12
R8288:Slc4a5	UTSW	6	83226255	missense	probably benign	0.01
R8397:Slc4a5	UTSW	6	83289326	critical splice donor site	probably null
R8849:Slc4a5	UTSW	6	83273198	missense	probably damaging	1.00
R9033:Slc4a5	UTSW	6	83260475	nonsense	probably null
R9133:Slc4a5	UTSW	6	83226235	missense	possibly damaging	0.85
R9201:Slc4a5	UTSW	6	83285830	missense	probably benign	0.02
R9269:Slc4a5	UTSW	6	83289241	missense	possibly damaging	0.88
R9603:Slc4a5	UTSW	6	83240732	missense	probably benign	0.34
R9781:Slc4a5	UTSW	6	83262484	missense	probably benign	0.00
Z1177:Slc4a5	UTSW	6	83280033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCACATATAGACGCCATGT -3'
(R):5'- CACAGTTCACCATGCCTGTG -3'

Sequencing Primer
(F):5'- GACGCCATGTCCTAATAAGCTTC -3'
(R):5'- TTCACCATGCCTGTGGGGTC -3'

Posted On

2016-03-01