Incidental Mutation 'R0422:Hyou1'
ID 37130
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 038624-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0422 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44300539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 869 (N869K)
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560]
AlphaFold Q9JKR6
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: N869K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: N869K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: N869K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: N869K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161147
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: N869K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: N869K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T A 7: 119,372,963 (GRCm39) Y155* probably null Het
Adamts16 A G 13: 70,887,074 (GRCm39) C937R probably damaging Het
Akna T C 4: 63,310,391 (GRCm39) D451G probably damaging Het
Alox12 A T 11: 70,145,384 (GRCm39) V63E probably damaging Het
Ap3b1 T C 13: 94,598,968 (GRCm39) I514T probably damaging Het
Arhgap23 T C 11: 97,354,478 (GRCm39) M286T probably damaging Het
Cdkl2 T C 5: 92,168,171 (GRCm39) D341G probably benign Het
Clip2 T C 5: 134,526,967 (GRCm39) D813G probably benign Het
Cntnap3 A G 13: 64,905,099 (GRCm39) V894A probably damaging Het
Coro2b T A 9: 62,335,259 (GRCm39) Y304F probably benign Het
Dclre1a T A 19: 56,532,567 (GRCm39) K676* probably null Het
Dmxl2 A G 9: 54,307,224 (GRCm39) probably null Het
Dpep3 A G 8: 106,702,750 (GRCm39) probably null Het
Efna5 C T 17: 62,914,414 (GRCm39) A177T probably benign Het
Fabp1 G A 6: 71,180,077 (GRCm39) V83I possibly damaging Het
H2-DMa G T 17: 34,356,921 (GRCm39) G140C probably damaging Het
Hectd4 T A 5: 121,481,145 (GRCm39) probably null Het
Ing1 G A 8: 11,611,933 (GRCm39) V124I probably damaging Het
Kalrn T A 16: 34,134,643 (GRCm39) I380F probably damaging Het
Kcnh1 A G 1: 192,019,888 (GRCm39) I378V probably benign Het
Kmt2c A G 5: 25,520,662 (GRCm39) V1816A probably benign Het
Matn2 G A 15: 34,435,917 (GRCm39) probably null Het
Naip2 C T 13: 100,297,621 (GRCm39) S805N probably benign Het
Napsa A C 7: 44,234,530 (GRCm39) Q254P probably damaging Het
Nat10 G T 2: 103,557,074 (GRCm39) S860* probably null Het
Nipbl T C 15: 8,381,112 (GRCm39) D560G probably benign Het
Nr3c2 A G 8: 77,912,596 (GRCm39) M736V probably benign Het
Or4k44 A T 2: 111,368,328 (GRCm39) F102Y probably damaging Het
Or7e174 A T 9: 20,012,744 (GRCm39) R230* probably null Het
Or8u8 A T 2: 86,011,566 (GRCm39) D296E probably benign Het
Palm3 A G 8: 84,755,492 (GRCm39) S335G possibly damaging Het
Panx1 G T 9: 14,919,112 (GRCm39) S249* probably null Het
Parvb A G 15: 84,179,812 (GRCm39) T231A probably benign Het
Pcdhb11 G T 18: 37,554,923 (GRCm39) L84F probably damaging Het
Pi4k2b T C 5: 52,925,096 (GRCm39) *447Q probably null Het
Ppp1r1a A G 15: 103,440,783 (GRCm39) S125P probably benign Het
Prss1 T A 6: 41,440,246 (GRCm39) D194E probably damaging Het
Rnf216 A T 5: 143,001,409 (GRCm39) C772* probably null Het
Rnf216 A T 5: 143,076,125 (GRCm39) F253Y probably benign Het
Rsf1 A T 7: 97,330,024 (GRCm39) E1183D probably benign Het
Rusc1 T C 3: 88,994,132 (GRCm39) T958A probably benign Het
Rxfp1 A G 3: 79,558,038 (GRCm39) M480T probably benign Het
Slc22a16 T A 10: 40,467,886 (GRCm39) V473E probably damaging Het
Slc26a3 A G 12: 31,515,848 (GRCm39) T583A possibly damaging Het
Slc7a15 T C 12: 8,584,400 (GRCm39) T117A probably benign Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Slitrk6 T A 14: 110,989,725 (GRCm39) probably benign Het
Spata31g1 T C 4: 42,972,199 (GRCm39) S511P possibly damaging Het
Spata7 A G 12: 98,624,524 (GRCm39) Y110C probably damaging Het
Supt16 T A 14: 52,421,453 (GRCm39) I31F probably benign Het
Taar7a T C 10: 23,869,172 (GRCm39) T70A probably benign Het
Top2a A G 11: 98,900,679 (GRCm39) F594L probably damaging Het
Unc13d C T 11: 115,960,846 (GRCm39) probably null Het
Unc80 T G 1: 66,522,497 (GRCm39) V233G probably damaging Het
Wdr91 A T 6: 34,857,781 (GRCm39) D735E probably damaging Het
Zzef1 A G 11: 72,756,917 (GRCm39) T1141A possibly damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44,295,978 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2233:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4393:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44,300,223 (GRCm39) critical splice donor site probably null
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6613:Hyou1 UTSW 9 44,293,795 (GRCm39) missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGGCTTTCAGCTCTGGATAATCTC -3'
(R):5'- TGCAGGTGGAATGACCTTCTCCTC -3'

Sequencing Primer
(F):5'- AGATGGACCAGGTCTTCACTG -3'
(R):5'- TCACCAGCACTGGCATTGAG -3'
Posted On 2013-05-09