Mutagenetix > Incidental Mutation

Incidental Mutation 'R4823:Sorl1'

371302

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

042439-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R4823 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41992321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1545 (D1545G)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably damaging
Transcript: ENSMUST00000060989
AA Change: D1545G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D1545G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Meta Mutation Damage Score

0.9667

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	A	5: 87,972,598	D405N	probably benign	Het
4921517D22Rik	T	G	13: 59,690,904	E38A	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,362	I152F	probably benign	Het
5830473C10Rik	T	A	5: 90,566,503	L124H	probably benign	Het
Aass	A	T	6: 23,107,691	D364E	probably benign	Het
Adamts2	A	G	11: 50,737,187	D238G	probably benign	Het
Aplf	G	A	6: 87,646,255	L302F	probably damaging	Het
Apol7b	G	T	15: 77,427,782		probably benign	Het
Arhgef12	A	G	9: 43,020,696	V165A	probably benign	Het
Ascc3	T	C	10: 50,713,233	S1017P	probably damaging	Het
B230104I21Rik	T	A	4: 154,349,747		probably benign	Het
Bfsp2	C	A	9: 103,479,883	C115F	probably damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
C87499	T	C	4: 88,629,215	K160R	probably damaging	Het
Capn5	A	T	7: 98,126,441	V431E	probably damaging	Het
Ccdc88c	A	G	12: 100,930,543	Y1390H	probably damaging	Het
Ccr3	A	G	9: 124,028,681	T18A	probably damaging	Het
Cdh5	T	C	8: 104,142,669	S676P	probably benign	Het
Ceacam5	A	G	7: 17,757,744	T680A	possibly damaging	Het
Cebpd	G	A	16: 15,888,114	G264S	probably benign	Het
Cfd	T	C	10: 79,890,948	V8A	probably benign	Het
Cops9	C	T	1: 92,641,866		probably benign	Het
Cpne6	T	C	14: 55,517,010	Y533H	probably damaging	Het
Cyp2c67	T	A	19: 39,615,724	H396L	probably benign	Het
Cyp2j9	G	A	4: 96,568,735	P500S	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,413		probably null	Het
Dbt	G	A	3: 116,523,387	D71N	probably damaging	Het
Ddx41	G	T	13: 55,532,055	Q440K	probably benign	Het
Doxl2	A	G	6: 48,975,261	D40G	probably damaging	Het
Elovl4	A	G	9: 83,780,685	F174S	probably damaging	Het
Emcn	C	G	3: 137,423,426	P193R	probably damaging	Het
Etnk1	T	C	6: 143,167,638		probably null	Het
Fads3	A	C	19: 10,041,888	S53R	probably damaging	Het
Fam193a	A	G	5: 34,459,028	E849G	probably damaging	Het
Fat3	A	G	9: 15,996,507	V2733A	probably benign	Het
Frem3	T	A	8: 80,613,958	M960K	probably benign	Het
Frmd6	A	T	12: 70,872,575	I62L	probably benign	Het
Glmp	T	C	3: 88,325,223		probably benign	Het
Gm17421	T	C	12: 113,369,541		noncoding transcript	Het
Gm27013	T	A	6: 130,522,223		noncoding transcript	Het
Gtf2ird1	A	G	5: 134,395,722	V390A	probably damaging	Het
Hps3	A	G	3: 20,012,726	Y559H	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr3	A	G	17: 27,085,147	D114G	probably benign	Het
Jmjd4	G	A	11: 59,455,580	A408T	probably benign	Het
Kcnh4	G	T	11: 100,755,174	A316D	probably damaging	Het
Klrg1	T	A	6: 122,273,533		probably null	Het
Lancl2	T	A	6: 57,732,277	Y355N	probably damaging	Het
Ltb	T	C	17: 35,195,230	S115P	probably benign	Het
Mccc2	T	G	13: 100,000,254	R64S	probably benign	Het
Mgam2-ps	T	A	6: 40,832,662		noncoding transcript	Het
Mrrf	T	G	2: 36,148,030	N104K	possibly damaging	Het
Nipa1	C	A	7: 55,979,688	V226L	possibly damaging	Het
Numa1	T	A	7: 101,996,037	L290Q	probably damaging	Het
Ofcc1	T	A	13: 40,280,473	H52L	probably damaging	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1176	A	G	2: 88,339,835	D90G	probably damaging	Het
Olfr1444	A	T	19: 12,861,816	I14F	probably benign	Het
Olfr1505	G	A	19: 13,919,658	V213I	probably benign	Het
Olfr292	T	A	7: 86,694,588	I44N	probably damaging	Het
P2ry12	G	A	3: 59,217,897	S119L	probably benign	Het
Pde7b	T	A	10: 20,438,785	N192Y	probably damaging	Het
Pfkl	T	C	10: 77,997,594	N258S	probably damaging	Het
Phykpl	G	A	11: 51,586,593	A71T	probably damaging	Het
Ppp1r16a	T	C	15: 76,693,193		probably benign	Het
Pramef20	T	C	4: 144,373,211	N328S	possibly damaging	Het
Prune2	C	T	19: 17,120,504	T1124M	probably damaging	Het
Rapgef6	A	G	11: 54,694,500	I1570V	probably benign	Het
Rbm34	T	C	8: 126,970,905	S19G	probably benign	Het
Rnf10	T	C	5: 115,255,442		probably null	Het
Rnf34	A	G	5: 122,850,302		probably null	Het
Setd4	A	G	16: 93,589,950	S287P	probably benign	Het
Shc3	C	T	13: 51,451,570	V225I	probably benign	Het
Sipa1l3	C	T	7: 29,371,002	V1030I	probably damaging	Het
Siva1	G	T	12: 112,645,064	R33L	probably damaging	Het
Slc4a5	C	T	6: 83,272,133	T573I	probably damaging	Het
Sorcs1	C	T	19: 50,678,140	R110Q	possibly damaging	Het
Sorcs1	T	C	19: 50,230,302	I581V	possibly damaging	Het
Tas2r124	T	G	6: 132,755,546	S273A	probably damaging	Het
Tcf15	T	C	2: 152,143,893	F90L	probably damaging	Het
Trim59	G	A	3: 69,037,120	R296C	probably benign	Het
Tulp1	A	T	17: 28,353,572	D229E	probably benign	Het
Ush1c	T	A	7: 46,195,733	N886I	probably benign	Het
Usp9y	A	T	Y: 1,444,559	S127T	probably damaging	Het
Vmn1r19	T	A	6: 57,405,234	Y257*	probably null	Het
Vmn2r109	A	T	17: 20,553,891	Y401N	probably damaging	Het
Vmn2r69	A	C	7: 85,411,300	S359A	probably benign	Het
Zfp37	A	T	4: 62,191,503	N479K	probably benign	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACACACCAAGGCTTTGCTG -3'
(R):5'- AGTTGTTCCAAGGAGCCAGC -3'

Sequencing Primer
(F):5'- TTTGCTGCCAGGGAAGAGC -3'
(R):5'- TCCGTAAATGTGGTGACCC -3'

Posted On

2016-03-01