Incidental Mutation 'R4823:Elovl4'
ID 371304
Institutional Source Beutler Lab
Gene Symbol Elovl4
Ensembl Gene ENSMUSG00000032262
Gene Name elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Synonyms
MMRRC Submission 042439-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4823 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 83778692-83806277 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83780685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 174 (F174S)
Ref Sequence ENSEMBL: ENSMUSP00000139163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034796] [ENSMUST00000183614]
AlphaFold Q9EQC4
Predicted Effect probably damaging
Transcript: ENSMUST00000034796
AA Change: F265S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034796
Gene: ENSMUSG00000032262
AA Change: F265S

DomainStartEndE-ValueType
Pfam:ELO 41 278 1e-69 PFAM
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183614
AA Change: F174S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139163
Gene: ENSMUSG00000032262
AA Change: F174S

DomainStartEndE-ValueType
Pfam:ELO 9 181 1.6e-50 PFAM
Meta Mutation Damage Score 0.9692 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before or around birth. Mice heterozygous for a null allele breed poorly and display mild retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Elovl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
hershey UTSW 9 83806038 start codon destroyed probably null 0.31
R0278:Elovl4 UTSW 9 83783195 missense probably benign 0.00
R0563:Elovl4 UTSW 9 83785034 critical splice donor site probably null
R0739:Elovl4 UTSW 9 83785109 missense probably damaging 1.00
R0771:Elovl4 UTSW 9 83785115 missense possibly damaging 0.95
R1970:Elovl4 UTSW 9 83780719 missense probably damaging 1.00
R2316:Elovl4 UTSW 9 83780773 missense probably damaging 1.00
R3777:Elovl4 UTSW 9 83785148 frame shift probably null
R3779:Elovl4 UTSW 9 83785148 frame shift probably null
R4827:Elovl4 UTSW 9 83806038 start codon destroyed probably null 0.31
R5264:Elovl4 UTSW 9 83780764 missense probably benign 0.19
R5275:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5295:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5361:Elovl4 UTSW 9 83790101 missense possibly damaging 0.95
R5364:Elovl4 UTSW 9 83790023 missense probably benign 0.21
R5897:Elovl4 UTSW 9 83790104 missense possibly damaging 0.50
R6433:Elovl4 UTSW 9 83785178 missense possibly damaging 0.46
R6668:Elovl4 UTSW 9 83805986 missense probably benign 0.02
R6844:Elovl4 UTSW 9 83790111 missense probably benign 0.09
R6897:Elovl4 UTSW 9 83783225 missense probably benign 0.05
R6933:Elovl4 UTSW 9 83785100 missense probably damaging 1.00
R7534:Elovl4 UTSW 9 83790119 missense probably damaging 1.00
R7544:Elovl4 UTSW 9 83783218 missense probably damaging 1.00
R7843:Elovl4 UTSW 9 83788271 missense probably damaging 1.00
R8303:Elovl4 UTSW 9 83788267 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCGGTTAAGGCCCAGTTC -3'
(R):5'- GCAGATTCTCAAACAGTAGAGC -3'

Sequencing Primer
(F):5'- CGGTTAAGGCCCAGTTCAATTTAC -3'
(R):5'- CCCTGTAGGAGACTGTGATGC -3'
Posted On 2016-03-01