Mutagenetix > Incidental Mutations

Incidental Mutation 'R4823:Ccr3'

371307

Institutional Source

Beutler Lab

Gene Symbol

Ccr3

Ensembl Gene

ENSMUSG00000035448

Gene Name

chemokine (C-C motif) receptor 3

Synonyms

CC-CKR3, MIP-1 alphaRL2, Cmkbr3, CKR3

MMRRC Submission

042439-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124021972-124031689 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124028681 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 18 (T18A)

Ref Sequence

ENSEMBL: ENSMUSP00000039107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039171]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039171
AA Change: T18A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039107
Gene: ENSMUSG00000035448
AA Change: T18A

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	49	320	7.9e-9	PFAM
Pfam:7tm_1	55	305	2.8e-52	PFAM

Meta Mutation Damage Score

0.2523

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in impaired eosinophil trafficking to the lungs and small intestine, and in increased bronchorestriction following methacholine challenge. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	A	5: 87,972,598	D405N	probably benign	Het
4921517D22Rik	T	G	13: 59,690,904	E38A	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,362	I152F	probably benign	Het
5830473C10Rik	T	A	5: 90,566,503	L124H	probably benign	Het
Aass	A	T	6: 23,107,691	D364E	probably benign	Het
Adamts2	A	G	11: 50,737,187	D238G	probably benign	Het
Aplf	G	A	6: 87,646,255	L302F	probably damaging	Het
Apol7b	G	T	15: 77,427,782		probably benign	Het
Arhgef12	A	G	9: 43,020,696	V165A	probably benign	Het
Ascc3	T	C	10: 50,713,233	S1017P	probably damaging	Het
B230104I21Rik	T	A	4: 154,349,747		probably benign	Het
Bfsp2	C	A	9: 103,479,883	C115F	probably damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
C87499	T	C	4: 88,629,215	K160R	probably damaging	Het
Capn5	A	T	7: 98,126,441	V431E	probably damaging	Het
Ccdc88c	A	G	12: 100,930,543	Y1390H	probably damaging	Het
Cdh5	T	C	8: 104,142,669	S676P	probably benign	Het
Ceacam5	A	G	7: 17,757,744	T680A	possibly damaging	Het
Cebpd	G	A	16: 15,888,114	G264S	probably benign	Het
Cfd	T	C	10: 79,890,948	V8A	probably benign	Het
Cops9	C	T	1: 92,641,866		probably benign	Het
Cpne6	T	C	14: 55,517,010	Y533H	probably damaging	Het
Cyp2c67	T	A	19: 39,615,724	H396L	probably benign	Het
Cyp2j9	G	A	4: 96,568,735	P500S	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,413		probably null	Het
Dbt	G	A	3: 116,523,387	D71N	probably damaging	Het
Ddx41	G	T	13: 55,532,055	Q440K	probably benign	Het
Doxl2	A	G	6: 48,975,261	D40G	probably damaging	Het
Elovl4	A	G	9: 83,780,685	F174S	probably damaging	Het
Emcn	C	G	3: 137,423,426	P193R	probably damaging	Het
Etnk1	T	C	6: 143,167,638		probably null	Het
Fads3	A	C	19: 10,041,888	S53R	probably damaging	Het
Fam193a	A	G	5: 34,459,028	E849G	probably damaging	Het
Fat3	A	G	9: 15,996,507	V2733A	probably benign	Het
Frem3	T	A	8: 80,613,958	M960K	probably benign	Het
Frmd6	A	T	12: 70,872,575	I62L	probably benign	Het
Glmp	T	C	3: 88,325,223		probably benign	Het
Gm17421	T	C	12: 113,369,541		noncoding transcript	Het
Gm27013	T	A	6: 130,522,223		noncoding transcript	Het
Gtf2ird1	A	G	5: 134,395,722	V390A	probably damaging	Het
Hps3	A	G	3: 20,012,726	Y559H	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr3	A	G	17: 27,085,147	D114G	probably benign	Het
Jmjd4	G	A	11: 59,455,580	A408T	probably benign	Het
Kcnh4	G	T	11: 100,755,174	A316D	probably damaging	Het
Klrg1	T	A	6: 122,273,533		probably null	Het
Lancl2	T	A	6: 57,732,277	Y355N	probably damaging	Het
Ltb	T	C	17: 35,195,230	S115P	probably benign	Het
Mccc2	T	G	13: 100,000,254	R64S	probably benign	Het
Mgam2-ps	T	A	6: 40,832,662		noncoding transcript	Het
Mrrf	T	G	2: 36,148,030	N104K	possibly damaging	Het
Nipa1	C	A	7: 55,979,688	V226L	possibly damaging	Het
Numa1	T	A	7: 101,996,037	L290Q	probably damaging	Het
Ofcc1	T	A	13: 40,280,473	H52L	probably damaging	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1176	A	G	2: 88,339,835	D90G	probably damaging	Het
Olfr1444	A	T	19: 12,861,816	I14F	probably benign	Het
Olfr1505	G	A	19: 13,919,658	V213I	probably benign	Het
Olfr292	T	A	7: 86,694,588	I44N	probably damaging	Het
P2ry12	G	A	3: 59,217,897	S119L	probably benign	Het
Pde7b	T	A	10: 20,438,785	N192Y	probably damaging	Het
Pfkl	T	C	10: 77,997,594	N258S	probably damaging	Het
Phykpl	G	A	11: 51,586,593	A71T	probably damaging	Het
Ppp1r16a	T	C	15: 76,693,193		probably benign	Het
Pramef20	T	C	4: 144,373,211	N328S	possibly damaging	Het
Prune2	C	T	19: 17,120,504	T1124M	probably damaging	Het
Rapgef6	A	G	11: 54,694,500	I1570V	probably benign	Het
Rbm34	T	C	8: 126,970,905	S19G	probably benign	Het
Rnf10	T	C	5: 115,255,442		probably null	Het
Rnf34	A	G	5: 122,850,302		probably null	Het
Setd4	A	G	16: 93,589,950	S287P	probably benign	Het
Shc3	C	T	13: 51,451,570	V225I	probably benign	Het
Sipa1l3	C	T	7: 29,371,002	V1030I	probably damaging	Het
Siva1	G	T	12: 112,645,064	R33L	probably damaging	Het
Slc4a5	C	T	6: 83,272,133	T573I	probably damaging	Het
Sorcs1	C	T	19: 50,678,140	R110Q	possibly damaging	Het
Sorcs1	T	C	19: 50,230,302	I581V	possibly damaging	Het
Sorl1	T	C	9: 41,992,321	D1545G	probably damaging	Het
Tas2r124	T	G	6: 132,755,546	S273A	probably damaging	Het
Tcf15	T	C	2: 152,143,893	F90L	probably damaging	Het
Trim59	G	A	3: 69,037,120	R296C	probably benign	Het
Tulp1	A	T	17: 28,353,572	D229E	probably benign	Het
Ush1c	T	A	7: 46,195,733	N886I	probably benign	Het
Usp9y	A	T	Y: 1,444,559	S127T	probably damaging	Het
Vmn1r19	T	A	6: 57,405,234	Y257*	probably null	Het
Vmn2r109	A	T	17: 20,553,891	Y401N	probably damaging	Het
Vmn2r69	A	C	7: 85,411,300	S359A	probably benign	Het
Zfp37	A	T	4: 62,191,503	N479K	probably benign	Het

Other mutations in Ccr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01916:Ccr3	APN	9	124029552	missense	probably damaging	1.00
IGL03388:Ccr3	APN	9	124028621	splice site	probably benign
PIT4810001:Ccr3	UTSW	9	124029608	missense	probably benign	0.00
R0077:Ccr3	UTSW	9	124029024	missense	probably damaging	1.00
R0118:Ccr3	UTSW	9	124029610	nonsense	probably null
R0504:Ccr3	UTSW	9	124029441	missense	possibly damaging	0.69
R0576:Ccr3	UTSW	9	124029009	missense	probably damaging	1.00
R0606:Ccr3	UTSW	9	124028802	missense	probably benign	0.07
R2108:Ccr3	UTSW	9	124029299	missense	possibly damaging	0.88
R3826:Ccr3	UTSW	9	124029677	missense	possibly damaging	0.95
R4583:Ccr3	UTSW	9	124029440	missense	probably benign	0.03
R4807:Ccr3	UTSW	9	124029297	missense	probably damaging	1.00
R4824:Ccr3	UTSW	9	124028772	missense	probably damaging	1.00
R4932:Ccr3	UTSW	9	124029006	missense	probably damaging	1.00
R5108:Ccr3	UTSW	9	124028931	missense	probably benign	0.05
R5590:Ccr3	UTSW	9	124028793	missense	probably damaging	1.00
R5610:Ccr3	UTSW	9	124029481	missense	probably damaging	1.00
R5981:Ccr3	UTSW	9	124028783	missense	probably damaging	0.99
R7764:Ccr3	UTSW	9	124029414	missense	probably benign	0.01
R7780:Ccr3	UTSW	9	124028952	missense	probably benign
R8035:Ccr3	UTSW	9	124028975	missense	probably benign
R8422:Ccr3	UTSW	9	124028762	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCCCCTACTTATAGCATTTCAG -3'
(R):5'- AATTGCCAAGTTGAACAGGTAG -3'

Sequencing Primer
(F):5'- GCATTTCAGATATATCTTG -3'
(R):5'- TGCCAAGTTGAACAGGTAGATATTAG -3'

Posted On

2016-03-01