Mutagenetix > Incidental Mutation

Incidental Mutation 'R0422:Dmxl2'

37131

Institutional Source

Beutler Lab

Gene Symbol

Dmxl2

Ensembl Gene

ENSMUSG00000041268

Gene Name

Dmx-like 2

Synonyms

E130119P06Rik, 6430411K14Rik

MMRRC Submission

038624-MU

Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0422 (G1)

Quality Score

195

Status

Not validated

Chromosome

Chromosomal Location

54365158-54501626 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 54399940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000118163

SMART Domains

Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
Pfam:Rav1p_C	1430	1903	1.5e-71	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2472	2490	N/A	INTRINSIC
low complexity region	2635	2649	N/A	INTRINSIC
low complexity region	2744	2766	N/A	INTRINSIC
WD40	2774	2809	5.73e0	SMART
WD40	2813	2852	8.88e0	SMART
WD40	2859	2901	2.67e-1	SMART
WD40	2907	2946	2.57e-2	SMART
WD40	2949	2988	3.61e-6	SMART
WD40	3001	3039	8.25e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000118600

SMART Domains

Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
low complexity region	1426	1436	N/A	INTRINSIC
Pfam:Rav1p_C	1447	1903	4.2e-68	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2471	2489	N/A	INTRINSIC
low complexity region	2722	2744	N/A	INTRINSIC
WD40	2752	2787	5.73e0	SMART
WD40	2791	2830	8.88e0	SMART
WD40	2837	2879	2.67e-1	SMART
WD40	2885	2924	2.57e-2	SMART
WD40	2927	2966	3.61e-6	SMART
WD40	2979	3017	8.25e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000123709

SMART Domains

Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
WD40	187	231	1.15e1	SMART
WD40	438	475	2.84e2	SMART
Pfam:Rav1p_C	632	1105	9.1e-72	PFAM
low complexity region	1180	1195	N/A	INTRINSIC
coiled coil region	1319	1347	N/A	INTRINSIC
low complexity region	1391	1406	N/A	INTRINSIC
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1674	1692	N/A	INTRINSIC
low complexity region	1925	1947	N/A	INTRINSIC
WD40	1955	1990	5.73e0	SMART
WD40	1994	2033	8.88e0	SMART
WD40	2040	2082	2.67e-1	SMART
WD40	2088	2127	2.57e-2	SMART
WD40	2130	2169	3.61e-6	SMART
WD40	2182	2220	8.25e0	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,199	S511P	possibly damaging	Het
Acsm3	T	A	7: 119,773,740	Y155*	probably null	Het
Adamts16	A	G	13: 70,738,955	C937R	probably damaging	Het
Akna	T	C	4: 63,392,154	D451G	probably damaging	Het
Alox12	A	T	11: 70,254,558	V63E	probably damaging	Het
Ap3b1	T	C	13: 94,462,460	I514T	probably damaging	Het
Arhgap23	T	C	11: 97,463,652	M286T	probably damaging	Het
Cdkl2	T	C	5: 92,020,312	D341G	probably benign	Het
Clip2	T	C	5: 134,498,113	D813G	probably benign	Het
Cntnap3	A	G	13: 64,757,285	V894A	probably damaging	Het
Coro2b	T	A	9: 62,427,977	Y304F	probably benign	Het
Dclre1a	T	A	19: 56,544,135	K676*	probably null	Het
Dpep3	A	G	8: 105,976,118		probably null	Het
Efna5	C	T	17: 62,607,419	A177T	probably benign	Het
Fabp1	G	A	6: 71,203,093	V83I	possibly damaging	Het
H2-DMa	G	T	17: 34,137,947	G140C	probably damaging	Het
Hectd4	T	A	5: 121,343,082		probably null	Het
Hyou1	T	A	9: 44,389,242	N869K	probably damaging	Het
Ing1	G	A	8: 11,561,933	V124I	probably damaging	Het
Kalrn	T	A	16: 34,314,273	I380F	probably damaging	Het
Kcnh1	A	G	1: 192,337,580	I378V	probably benign	Het
Kmt2c	A	G	5: 25,315,664	V1816A	probably benign	Het
Matn2	G	A	15: 34,435,771		probably null	Het
Naip2	C	T	13: 100,161,113	S805N	probably benign	Het
Napsa	A	C	7: 44,585,106	Q254P	probably damaging	Het
Nat10	G	T	2: 103,726,729	S860*	probably null	Het
Nipbl	T	C	15: 8,351,628	D560G	probably benign	Het
Nr3c2	A	G	8: 77,185,967	M736V	probably benign	Het
Olfr1294	A	T	2: 111,537,983	F102Y	probably damaging	Het
Olfr52	A	T	2: 86,181,222	D296E	probably benign	Het
Olfr868	A	T	9: 20,101,448	R230*	probably null	Het
Palm3	A	G	8: 84,028,863	S335G	possibly damaging	Het
Panx1	G	T	9: 15,007,816	S249*	probably null	Het
Parvb	A	G	15: 84,295,611	T231A	probably benign	Het
Pcdhb11	G	T	18: 37,421,870	L84F	probably damaging	Het
Pi4k2b	T	C	5: 52,767,754	*447Q	probably null	Het
Ppp1r1a	A	G	15: 103,532,356	S125P	probably benign	Het
Prss1	T	A	6: 41,463,312	D194E	probably damaging	Het
Rnf216	A	T	5: 143,015,654	C772*	probably null	Het
Rnf216	A	T	5: 143,090,370	F253Y	probably benign	Het
Rsf1	A	T	7: 97,680,817	E1183D	probably benign	Het
Rusc1	T	C	3: 89,086,825	T958A	probably benign	Het
Rxfp1	A	G	3: 79,650,731	M480T	probably benign	Het
Slc22a16	T	A	10: 40,591,890	V473E	probably damaging	Het
Slc26a3	A	G	12: 31,465,849	T583A	possibly damaging	Het
Slc7a15	T	C	12: 8,534,400	T117A	probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Slitrk6	T	A	14: 110,752,293		probably benign	Het
Spata7	A	G	12: 98,658,265	Y110C	probably damaging	Het
Supt16	T	A	14: 52,183,996	I31F	probably benign	Het
Taar7a	T	C	10: 23,993,274	T70A	probably benign	Het
Top2a	A	G	11: 99,009,853	F594L	probably damaging	Het
Unc13d	C	T	11: 116,070,020		probably null	Het
Unc80	T	G	1: 66,483,338	V233G	probably damaging	Het
Wdr91	A	T	6: 34,880,846	D735E	probably damaging	Het
Zzef1	A	G	11: 72,866,091	T1141A	possibly damaging	Het

Other mutations in Dmxl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dmxl2	APN	9	54401704	missense	probably benign
IGL00226:Dmxl2	APN	9	54415993	missense	probably damaging	1.00
IGL00419:Dmxl2	APN	9	54406667	missense	probably damaging	0.96
IGL00551:Dmxl2	APN	9	54450838	missense	probably damaging	1.00
IGL00765:Dmxl2	APN	9	54415422	unclassified	probably benign
IGL00852:Dmxl2	APN	9	54423313	nonsense	probably null
IGL00857:Dmxl2	APN	9	54376320	missense	probably benign	0.32
IGL00952:Dmxl2	APN	9	54416882	missense	probably damaging	0.99
IGL01139:Dmxl2	APN	9	54458964	missense	probably damaging	1.00
IGL01346:Dmxl2	APN	9	54415475	missense	probably damaging	1.00
IGL01538:Dmxl2	APN	9	54445376	splice site	probably benign
IGL01645:Dmxl2	APN	9	54378733	missense	possibly damaging	0.93
IGL02096:Dmxl2	APN	9	54401065	missense	possibly damaging	0.89
IGL02104:Dmxl2	APN	9	54404015	nonsense	probably null
IGL02145:Dmxl2	APN	9	54374697	missense	probably benign	0.29
IGL02210:Dmxl2	APN	9	54404049	missense	probably damaging	1.00
IGL02238:Dmxl2	APN	9	54445433	missense	probably damaging	1.00
IGL02255:Dmxl2	APN	9	54393768	missense	probably benign	0.06
IGL02364:Dmxl2	APN	9	54393843	missense	probably benign	0.02
IGL02423:Dmxl2	APN	9	54393748	missense	possibly damaging	0.89
IGL02440:Dmxl2	APN	9	54406615	missense	probably damaging	0.98
IGL02546:Dmxl2	APN	9	54366414	utr 3 prime	probably benign
IGL02668:Dmxl2	APN	9	54416945	missense	probably damaging	1.00
IGL03229:Dmxl2	APN	9	54404172	missense	probably damaging	1.00
IGL03244:Dmxl2	APN	9	54416371	missense	probably damaging	1.00
IGL03277:Dmxl2	APN	9	54404220	missense	probably damaging	1.00
IGL03399:Dmxl2	APN	9	54446672	missense	probably damaging	1.00
BB003:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
BB013:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
I2288:Dmxl2	UTSW	9	54401793	missense	probably damaging	1.00
P0014:Dmxl2	UTSW	9	54401764	missense	probably damaging	1.00
R0411:Dmxl2	UTSW	9	54378939	missense	probably damaging	1.00
R0432:Dmxl2	UTSW	9	54416951	missense	probably benign	0.01
R0436:Dmxl2	UTSW	9	54383750	missense	probably damaging	1.00
R0538:Dmxl2	UTSW	9	54393836	missense	probably benign	0.06
R0603:Dmxl2	UTSW	9	54405906	missense	possibly damaging	0.95
R0605:Dmxl2	UTSW	9	54419945	missense	probably benign	0.01
R0625:Dmxl2	UTSW	9	54382702	missense	probably benign
R0626:Dmxl2	UTSW	9	54416554	missense	probably damaging	1.00
R0736:Dmxl2	UTSW	9	54378817	missense	probably damaging	0.99
R0847:Dmxl2	UTSW	9	54405828	missense	probably damaging	1.00
R0855:Dmxl2	UTSW	9	54366440	missense	probably benign	0.03
R0962:Dmxl2	UTSW	9	54446412	missense	probably damaging	0.99
R1015:Dmxl2	UTSW	9	54367765	missense	probably benign	0.32
R1084:Dmxl2	UTSW	9	54416433	missense	probably damaging	1.00
R1328:Dmxl2	UTSW	9	54396249	missense	probably benign	0.12
R1401:Dmxl2	UTSW	9	54415428	critical splice donor site	probably null
R1503:Dmxl2	UTSW	9	54446988	nonsense	probably null
R1609:Dmxl2	UTSW	9	54409263	missense	possibly damaging	0.90
R1613:Dmxl2	UTSW	9	54382027	missense	probably benign
R1660:Dmxl2	UTSW	9	54451030	missense	possibly damaging	0.68
R1712:Dmxl2	UTSW	9	54401485	missense	probably benign	0.00
R1772:Dmxl2	UTSW	9	54423224	splice site	probably benign
R1832:Dmxl2	UTSW	9	54460949	missense	probably damaging	0.97
R1922:Dmxl2	UTSW	9	54401523	missense	probably benign
R2104:Dmxl2	UTSW	9	54415564	missense	probably damaging	1.00
R2109:Dmxl2	UTSW	9	54393813	missense	probably benign	0.06
R2145:Dmxl2	UTSW	9	54415910	missense	probably damaging	1.00
R2199:Dmxl2	UTSW	9	54376243	missense	probably benign	0.35
R2352:Dmxl2	UTSW	9	54393862	missense	probably damaging	1.00
R2516:Dmxl2	UTSW	9	54400094	missense	probably damaging	1.00
R2981:Dmxl2	UTSW	9	54393702	missense	probably damaging	1.00
R3430:Dmxl2	UTSW	9	54477461	missense	possibly damaging	0.94
R3625:Dmxl2	UTSW	9	54393643	missense	probably benign	0.23
R3725:Dmxl2	UTSW	9	54393769	missense	probably damaging	1.00
R3787:Dmxl2	UTSW	9	54369878	missense	probably damaging	1.00
R4002:Dmxl2	UTSW	9	54473832	splice site	probably benign
R4004:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4005:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4012:Dmxl2	UTSW	9	54379013	splice site	probably null
R4014:Dmxl2	UTSW	9	54378709	splice site	probably null
R4115:Dmxl2	UTSW	9	54446988	nonsense	probably null
R4232:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R4388:Dmxl2	UTSW	9	54396267	missense	probably damaging	1.00
R4513:Dmxl2	UTSW	9	54419884	missense	probably null	0.17
R4552:Dmxl2	UTSW	9	54451763	missense	probably damaging	1.00
R4609:Dmxl2	UTSW	9	54446512	missense	probably damaging	1.00
R4625:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R4694:Dmxl2	UTSW	9	54446905	missense	probably benign	0.04
R4711:Dmxl2	UTSW	9	54450924	missense	probably benign	0.37
R4715:Dmxl2	UTSW	9	54446405	splice site	probably null
R4746:Dmxl2	UTSW	9	54451796	missense	probably benign	0.04
R4789:Dmxl2	UTSW	9	54379815	missense	probably benign	0.30
R4825:Dmxl2	UTSW	9	54404041	missense	probably benign	0.01
R4911:Dmxl2	UTSW	9	54411653	missense	probably damaging	1.00
R4995:Dmxl2	UTSW	9	54501441	utr 5 prime	probably benign
R5026:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R5118:Dmxl2	UTSW	9	54460987	missense	probably damaging	1.00
R5174:Dmxl2	UTSW	9	54445484	splice site	probably null
R5288:Dmxl2	UTSW	9	54378757	missense	probably benign
R5373:Dmxl2	UTSW	9	54369189	intron	probably benign
R5374:Dmxl2	UTSW	9	54369189	intron	probably benign
R5385:Dmxl2	UTSW	9	54378757	missense	probably benign
R5386:Dmxl2	UTSW	9	54378757	missense	probably benign
R5418:Dmxl2	UTSW	9	54374651	critical splice donor site	probably null
R5540:Dmxl2	UTSW	9	54393857	missense	probably benign	0.21
R5568:Dmxl2	UTSW	9	54423359	splice site	probably null
R5733:Dmxl2	UTSW	9	54376266	missense	possibly damaging	0.64
R5758:Dmxl2	UTSW	9	54472964	missense	probably benign	0.28
R5759:Dmxl2	UTSW	9	54375508	missense	probably damaging	1.00
R5893:Dmxl2	UTSW	9	54387420	missense	possibly damaging	0.64
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6041:Dmxl2	UTSW	9	54416753	missense	probably damaging	1.00
R6174:Dmxl2	UTSW	9	54393727	missense	probably damaging	1.00
R6278:Dmxl2	UTSW	9	54415762	missense	probably damaging	1.00
R6307:Dmxl2	UTSW	9	54382706	missense	possibly damaging	0.68
R6349:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R6404:Dmxl2	UTSW	9	54375536	missense	probably damaging	1.00
R6516:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R6712:Dmxl2	UTSW	9	54411624	missense	probably damaging	1.00
R6747:Dmxl2	UTSW	9	54416088	missense	probably damaging	1.00
R6769:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6771:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6800:Dmxl2	UTSW	9	54409183	missense	probably damaging	1.00
R6891:Dmxl2	UTSW	9	54480380	missense	probably damaging	0.99
R6920:Dmxl2	UTSW	9	54472212	missense	probably damaging	1.00
R6979:Dmxl2	UTSW	9	54450879	missense	possibly damaging	0.49
R7147:Dmxl2	UTSW	9	54416729	missense	probably benign	0.06
R7327:Dmxl2	UTSW	9	54401585	missense	probably damaging	1.00
R7462:Dmxl2	UTSW	9	54366632	splice site	probably null
R7526:Dmxl2	UTSW	9	54400957	missense	possibly damaging	0.47
R7569:Dmxl2	UTSW	9	54415987	missense	possibly damaging	0.51
R7622:Dmxl2	UTSW	9	54472218	missense	probably damaging	0.99
R7638:Dmxl2	UTSW	9	54457794	missense	unknown
R7703:Dmxl2	UTSW	9	54461086	missense	probably benign	0.01
R7768:Dmxl2	UTSW	9	54380939	missense	probably damaging	1.00
R7926:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
R7969:Dmxl2	UTSW	9	54446881	missense	possibly damaging	0.85
R8007:Dmxl2	UTSW	9	54383691	nonsense	probably null
R8200:Dmxl2	UTSW	9	54480346	missense	probably benign
R8311:Dmxl2	UTSW	9	54446933	missense	probably benign	0.00
R8320:Dmxl2	UTSW	9	54383759	missense	probably benign
R8377:Dmxl2	UTSW	9	54378748	missense	probably damaging	1.00
R8400:Dmxl2	UTSW	9	54383753	missense	probably benign	0.03
R8509:Dmxl2	UTSW	9	54428057	nonsense	probably null
R8698:Dmxl2	UTSW	9	54374669	missense	probably benign	0.10
R8768:Dmxl2	UTSW	9	54393821	missense	possibly damaging	0.83
R8770:Dmxl2	UTSW	9	54404014	missense	probably benign	0.01
R8799:Dmxl2	UTSW	9	54419743	critical splice donor site	probably null
R8840:Dmxl2	UTSW	9	54401855	missense	possibly damaging	0.58
R8898:Dmxl2	UTSW	9	54401657	missense	probably benign	0.01
R8954:Dmxl2	UTSW	9	54473872	missense	probably benign	0.04
R9083:Dmxl2	UTSW	9	54409264	missense	probably benign	0.29
R9114:Dmxl2	UTSW	9	54400037	missense
R9115:Dmxl2	UTSW	9	54401727	missense	probably benign
R9263:Dmxl2	UTSW	9	54451661	missense	probably benign	0.01
R9272:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R9577:Dmxl2	UTSW	9	54416380	missense	unknown
R9673:Dmxl2	UTSW	9	54387556	missense	probably damaging	1.00
R9722:Dmxl2	UTSW	9	54416608	missense	probably benign	0.00
R9726:Dmxl2	UTSW	9	54415712	missense	probably benign	0.09
R9797:Dmxl2	UTSW	9	54450903	missense	probably benign	0.00
X0064:Dmxl2	UTSW	9	54401713	missense	probably benign
Z1177:Dmxl2	UTSW	9	54382034	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CACTGCTTTCACAGCAATCTTGAACTC -3'
(R):5'- GCCACCTGCATTTACTGTGTAGCC -3'

Sequencing Primer
(F):5'- GCAATCTTGAACTCCTCAGAAGTG -3'
(R):5'- TACAGTGAAGCAGCTCCAGTC -3'

Posted On

2013-05-09