Incidental Mutation 'R4823:Kcnh4'
ID371316
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission 042439-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4823 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100755174 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 316 (A316D)
Ref Sequence ENSEMBL: ENSMUSP00000102986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107361] [ENSMUST00000107363]
Predicted Effect probably damaging
Transcript: ENSMUST00000107361
AA Change: A316D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: A316D

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107363
AA Change: A316D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: A316D

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Meta Mutation Damage Score 0.9679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0436:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R0613:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5682:Kcnh4 UTSW 11 100749802 missense possibly damaging 0.82
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
R7353:Kcnh4 UTSW 11 100757199 missense probably benign 0.18
R7355:Kcnh4 UTSW 11 100752443 missense possibly damaging 0.92
R7544:Kcnh4 UTSW 11 100757080 missense probably benign 0.25
R7563:Kcnh4 UTSW 11 100741854 missense probably benign 0.00
R7664:Kcnh4 UTSW 11 100750322 missense probably damaging 1.00
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CCAAGAGCATAGACCCTTTGG -3'
(R):5'- AGCTACCTGACCTGAGAGTTC -3'

Sequencing Primer
(F):5'- AGTGCCTGGCTCAGAGCTATG -3'
(R):5'- AGTTCAGGCTATGGTCCCTAGC -3'
Posted On2016-03-01