Incidental Mutation 'R0422:Coro2b'
ID37132
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Namecoronin, actin binding protein, 2B
Synonyms
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0422 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62419492-62537044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62427977 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 304 (Y304F)
Ref Sequence ENSEMBL: ENSMUSP00000128441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000173171] [ENSMUST00000174439]
Predicted Effect probably benign
Transcript: ENSMUST00000048043
AA Change: Y309F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729
AA Change: Y309F

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131981
AA Change: Y8F
SMART Domains Protein: ENSMUSP00000133481
Gene: ENSMUSG00000041729
AA Change: Y8F

DomainStartEndE-ValueType
DUF1900 3 97 6.37e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151604
Predicted Effect probably benign
Transcript: ENSMUST00000164246
AA Change: Y304F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729
AA Change: Y304F

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173171
SMART Domains Protein: ENSMUSP00000134709
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 16 80 2.89e-31 SMART
Pfam:WD40 87 121 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174439
SMART Domains Protein: ENSMUSP00000134079
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
WD40 1 41 4.95e-4 SMART
WD40 44 83 1.33e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62425808 missense probably damaging 0.99
IGL01834:Coro2b APN 9 62431357 missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62428961 nonsense probably null
PIT4151001:Coro2b UTSW 9 62429004 missense probably damaging 1.00
R0835:Coro2b UTSW 9 62425837 missense possibly damaging 0.68
R0944:Coro2b UTSW 9 62427981 missense probably benign 0.08
R1115:Coro2b UTSW 9 62431327 missense probably damaging 0.96
R1254:Coro2b UTSW 9 62428965 missense probably damaging 0.98
R1422:Coro2b UTSW 9 62428947 critical splice donor site probably null
R1532:Coro2b UTSW 9 62489423 missense probably damaging 1.00
R1543:Coro2b UTSW 9 62425841 missense probably benign 0.32
R3424:Coro2b UTSW 9 62429308 unclassified probably null
R3971:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R3972:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62425789 unclassified probably benign
R4233:Coro2b UTSW 9 62426185 missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62426578 missense probably benign 0.02
R4825:Coro2b UTSW 9 62454623 missense probably benign 0.30
R5332:Coro2b UTSW 9 62429230 missense probably damaging 0.97
R5702:Coro2b UTSW 9 62426577 missense probably damaging 0.97
R6474:Coro2b UTSW 9 62426628 missense probably benign 0.16
R6500:Coro2b UTSW 9 62489324 missense probably benign 0.24
R6674:Coro2b UTSW 9 62432427 missense probably damaging 1.00
R7102:Coro2b UTSW 9 62421385 missense possibly damaging 0.81
R7347:Coro2b UTSW 9 62489372 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCTGCTGACAGAGATAGCC -3'
(R):5'- CCTGCCCCTAGTAGAGCTACCAAG -3'

Sequencing Primer
(F):5'- TGCCATGAGTGACAGGCTG -3'
(R):5'- CTACCAAGGCACAGGGTTAG -3'
Posted On2013-05-09