Incidental Mutation 'R4823:Ppp1r16a'
ID371329
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16A
SynonymsR75527, Mypt3, 2900084E10Rik
MMRRC Submission 042439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4823 (G1)
Quality Score223
Status Validated
Chromosome15
Chromosomal Location76671615-76694919 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 76693193 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000231028]
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143274
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76694544 missense probably benign
IGL01449:Ppp1r16a APN 15 76694294 unclassified probably benign
IGL02128:Ppp1r16a APN 15 76693978 missense probably benign
IGL02331:Ppp1r16a APN 15 76691000 missense probably benign
R0057:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0060:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0113:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0114:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0244:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0352:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0646:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0652:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0722:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0744:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0833:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0834:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0835:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0836:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0885:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0942:Ppp1r16a UTSW 15 76694011 missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1168:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1170:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1171:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1503:Ppp1r16a UTSW 15 76694399 missense probably benign
R1572:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1914:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76693596 missense probably damaging 0.99
R5153:Ppp1r16a UTSW 15 76694396 nonsense probably null
R5443:Ppp1r16a UTSW 15 76694646 missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76691021 missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76691723 missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76690904 missense probably damaging 1.00
R7686:Ppp1r16a UTSW 15 76694583 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCTCAGGTATCACCCAGGAG -3'
(R):5'- CACAAGCAATTCTACCAGGTGTAC -3'

Sequencing Primer
(F):5'- CCAGGAGGGCATTGAGGAG -3'
(R):5'- TCTAGTGAGAGCCCGGAACCTAC -3'
Posted On2016-03-01