Incidental Mutation 'R4823:Fads3'
ID371336
Institutional Source Beutler Lab
Gene Symbol Fads3
Ensembl Gene ENSMUSG00000024664
Gene Namefatty acid desaturase 3
Synonyms
MMRRC Submission 042439-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4823 (G1)
Quality Score206
Status Not validated
Chromosome19
Chromosomal Location10041548-10059671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 10041888 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 53 (S53R)
Ref Sequence ENSEMBL: ENSMUSP00000111659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115995] [ENSMUST00000144788]
Predicted Effect probably damaging
Transcript: ENSMUST00000115995
AA Change: S53R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111659
Gene: ENSMUSG00000024664
AA Change: S53R

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Cyt-b5 27 101 6.21e-16 SMART
Pfam:FA_desaturase 162 423 4.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144788
SMART Domains Protein: ENSMUSP00000121449
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 89 198 4.4e-30 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout affects highly unsaturated fatty acid levels in the liver and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
Ascc3 T C 10: 50,713,233 S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Fads3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fads3 APN 19 10052299 missense probably null 0.98
IGL00422:Fads3 APN 19 10055681 missense possibly damaging 0.80
IGL01081:Fads3 APN 19 10053002 missense probably benign 0.00
IGL02454:Fads3 APN 19 10055119 missense probably damaging 0.97
IGL02477:Fads3 APN 19 10056442 missense probably damaging 1.00
R0611:Fads3 UTSW 19 10041836 missense probably damaging 1.00
R1169:Fads3 UTSW 19 10054099 missense possibly damaging 0.82
R1400:Fads3 UTSW 19 10056300 splice site probably null
R1893:Fads3 UTSW 19 10056504 missense probably benign
R2508:Fads3 UTSW 19 10056454 missense probably damaging 1.00
R3151:Fads3 UTSW 19 10057898 missense probably benign 0.01
R4543:Fads3 UTSW 19 10041811 missense possibly damaging 0.60
R4766:Fads3 UTSW 19 10056020 missense possibly damaging 0.94
R5117:Fads3 UTSW 19 10041958 critical splice donor site probably null
R5846:Fads3 UTSW 19 10053033 missense probably null 1.00
R6117:Fads3 UTSW 19 10054267 missense probably damaging 1.00
R6225:Fads3 UTSW 19 10041838 missense probably benign 0.25
X0027:Fads3 UTSW 19 10054250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTGTACAGCGGCAATGG -3'
(R):5'- CTCCATCTCAACTCTGGAGC -3'

Sequencing Primer
(F):5'- CAATGGGCGGTGTCGGG -3'
(R):5'- TCTGGAGCCAGGGAAGG -3'
Posted On2016-03-01