Incidental Mutation 'R0422:Slc22a16'
ID37134
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0422 (G1)
Quality Score213
Status Not validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40591890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 473 (V473E)
Ref Sequence ENSEMBL: ENSMUSP00000077428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect probably damaging
Transcript: ENSMUST00000019978
AA Change: V494E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: V494E

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078314
AA Change: V473E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: V473E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAATGCACGCTTTGCTTTGAGGG -3'
(R):5'- TCTAGACTGGAGACCATGATACCAACC -3'

Sequencing Primer
(F):5'- CTCACACATGCCTGTTGAATAAGG -3'
(R):5'- Tacacacacacacacacacac -3'
Posted On2013-05-09