Mutagenetix > Incidental Mutation

Incidental Mutation 'R4825:Etl4'

371351

Institutional Source

Beutler Lab

Gene Symbol

Etl4

Ensembl Gene

ENSMUSG00000036617

Gene Name

enhancer trap locus 4

Synonyms

6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4

MMRRC Submission

042441-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.714) question?

Stock #

R4825 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19909780-20810713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20806927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1274 (I1274V)

Ref Sequence

ENSEMBL: ENSMUSP00000110255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]

AlphaFold

A2AQ25

Predicted Effect

probably benign
Transcript: ENSMUST00000045555

SMART Domains

Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1067	1096	N/A	INTRINSIC
low complexity region	1212	1231	N/A	INTRINSIC
low complexity region	1296	1314	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066509
AA Change: I1591V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: I1591V

Domain	Start	End	E-Value	Type
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1372	1381	N/A	INTRINSIC
low complexity region	1470	1495	N/A	INTRINSIC
low complexity region	1571	1582	N/A	INTRINSIC
coiled coil region	1658	1686	N/A	INTRINSIC
low complexity region	1724	1737	N/A	INTRINSIC
low complexity region	1806	1825	N/A	INTRINSIC
low complexity region	1890	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114604

SMART Domains

Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1207	1226	N/A	INTRINSIC
low complexity region	1291	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114606

SMART Domains

Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114607

SMART Domains

Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114608
AA Change: I1274V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: I1274V

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC
low complexity region	1055	1064	N/A	INTRINSIC
low complexity region	1153	1178	N/A	INTRINSIC
low complexity region	1254	1265	N/A	INTRINSIC
coiled coil region	1341	1369	N/A	INTRINSIC
low complexity region	1407	1420	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114614

SMART Domains

Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
low complexity region	1201	1220	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114627
AA Change: I1642V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: I1642V

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
Pfam:AIP3	239	341	2.4e-14	PFAM
low complexity region	364	379	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
Pfam:AIP3	600	841	1.1e-12	PFAM
low complexity region	1153	1182	N/A	INTRINSIC
low complexity region	1423	1432	N/A	INTRINSIC
low complexity region	1521	1546	N/A	INTRINSIC
low complexity region	1622	1633	N/A	INTRINSIC
coiled coil region	1709	1737	N/A	INTRINSIC
low complexity region	1775	1788	N/A	INTRINSIC
low complexity region	1857	1876	N/A	INTRINSIC
low complexity region	1941	1959	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139531

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156587

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	A	11: 109,791,672	L229F	probably benign	Het
A930002H24Rik	A	C	17: 63,863,608	S62A	unknown	Het
Abca12	T	A	1: 71,302,685	Q1039L	possibly damaging	Het
Adgrg5	T	A	8: 94,941,734	F476I	possibly damaging	Het
AI314180	G	A	4: 58,850,911	L421F	probably damaging	Het
Alms1	A	G	6: 85,678,245	K2789E	probably damaging	Het
Arrdc2	G	A	8: 70,839,277		probably null	Het
Atp2b1	T	A	10: 99,009,564	I743K	probably damaging	Het
Atp6v1c2	C	T	12: 17,289,060	G230D	probably benign	Het
AU040320	G	A	4: 126,791,793	C54Y	probably damaging	Het
BC024139	C	T	15: 76,120,317	V680I	possibly damaging	Het
Bckdhb	A	G	9: 83,988,905	D156G	probably damaging	Het
Canx	T	A	11: 50,308,809	D143V	probably benign	Het
Ccdc180	T	A	4: 45,912,794	V591E	possibly damaging	Het
Ccno	T	C	13: 112,988,099	S68P	probably benign	Het
Cdc45	C	T	16: 18,784,863	E527K	probably damaging	Het
Cep290	T	A	10: 100,488,348	D14E	probably damaging	Het
Cgnl1	A	G	9: 71,630,524	V1238A	probably benign	Het
Ciz1	C	T	2: 32,371,741	A455V	probably damaging	Het
Coro2b	T	A	9: 62,454,623	Y86F	probably benign	Het
Csf2ra	C	T	19: 61,226,552	R158Q	probably benign	Het
Cubn	A	T	2: 13,325,225	I2615N	probably damaging	Het
Dhx8	C	T	11: 101,738,170	R129*	probably null	Het
Disc1	T	A	8: 125,135,302	M471K	possibly damaging	Het
Dmxl2	G	T	9: 54,404,041	L1799I	probably benign	Het
Dnah2	A	G	11: 69,423,205	S4108P	probably damaging	Het
Ehmt2	C	G	17: 34,906,964	P211R	probably benign	Het
Eif4g3	A	G	4: 138,194,081	D1557G	probably benign	Het
Epha5	T	C	5: 84,233,840	D384G	probably damaging	Het
Fam160a1	G	A	3: 85,673,432	P489S	possibly damaging	Het
Fip1l1	G	A	5: 74,588,205		probably null	Het
Fubp1	T	C	3: 152,217,890		probably null	Het
Glul	T	C	1: 153,903,044	V33A	probably benign	Het
Gm4846	A	G	1: 166,491,668	F167S	probably damaging	Het
Heatr6	T	A	11: 83,758,322	L168M	probably damaging	Het
Hif1a	T	A	12: 73,932,401	I233N	probably damaging	Het
Hivep2	T	A	10: 14,131,319	H1220Q	possibly damaging	Het
Igkv8-21	T	C	6: 70,315,426	I9M	probably benign	Het
Izumo1	T	A	7: 45,624,987	C62*	probably null	Het
Jakmip3	G	A	7: 139,026,766	E424K	probably damaging	Het
Klhl2	A	G	8: 64,752,813	V358A	probably damaging	Het
Klk10	C	G	7: 43,783,598	D139E	probably damaging	Het
Klk14	T	C	7: 43,692,076	C51R	probably damaging	Het
Klk5	T	G	7: 43,845,390	I99S	probably damaging	Het
L3hypdh	T	C	12: 72,077,393	T258A	probably benign	Het
Lrp5	A	G	19: 3,614,292	Y812H	probably damaging	Het
Lrrc40	T	A	3: 158,061,330	L474*	probably null	Het
Mkks	A	T	2: 136,880,655	M194K	probably benign	Het
Mmp20	A	G	9: 7,654,120	D347G	probably damaging	Het
Mmp27	A	G	9: 7,581,194	E460G	probably damaging	Het
Mms22l	T	C	4: 24,536,226	F605S	probably damaging	Het
Mpzl3	A	G	9: 45,068,329	S193G	probably benign	Het
Muc4	A	T	16: 32,751,747	T542S	probably benign	Het
Muc5b	T	C	7: 141,868,465	L4446P	possibly damaging	Het
Mxi1	C	A	19: 53,370,338	S131*	probably null	Het
Nanog	G	T	6: 122,713,340	A210S	probably benign	Het
Nrcam	C	T	12: 44,575,986	Q988*	probably null	Het
Nsg1	C	A	5: 38,159,047		probably benign	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1121	T	A	2: 87,372,088	C185*	probably null	Het
Olfr1228	T	C	2: 89,248,690		probably null	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	A	2: 89,978,153	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,314,320		probably null	Het
Olfr548-ps1	T	A	7: 102,542,380	V148E	possibly damaging	Het
Olfr58	T	G	9: 19,783,576	S148A	possibly damaging	Het
Olfr632	T	C	7: 103,937,503	V41A	probably benign	Het
Olfr920	A	T	9: 38,756,407	T240S	probably damaging	Het
Olfr980	A	T	9: 40,006,742	M69K	possibly damaging	Het
Orc3	A	T	4: 34,571,774	M665K	possibly damaging	Het
Pabpc1	A	G	15: 36,597,011	S591P	probably damaging	Het
Parp6	T	A	9: 59,624,362		probably null	Het
Pcdh1	T	C	18: 38,189,859	M974V	possibly damaging	Het
Pcdhb22	T	A	18: 37,520,660	V727E	possibly damaging	Het
Pex5l	T	C	3: 32,992,985	E272G	probably damaging	Het
Pglyrp2	G	T	17: 32,418,261	N264K	probably benign	Het
Phxr4	T	A	9: 13,431,586		probably benign	Het
Piezo2	A	G	18: 63,144,954	F293S	probably damaging	Het
Pkhd1	T	C	1: 20,537,401	D1077G	probably damaging	Het
Plekhs1	A	G	19: 56,473,268		probably null	Het
Prex1	G	T	2: 166,585,857	C788*	probably null	Het
Prrt3	A	T	6: 113,498,138	M41K	probably benign	Het
Ptgir	T	C	7: 16,908,843	V326A	probably damaging	Het
Ptprg	T	A	14: 12,220,654	D455E	probably damaging	Het
Ptpru	T	A	4: 131,799,603	Q686L	probably benign	Het
Pxdc1	G	T	13: 34,630,360	T190K	probably benign	Het
Rap1b	A	T	10: 117,818,582	C118S	probably benign	Het
Rapgef2	T	C	3: 79,083,227	M915V	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpe65	C	T	3: 159,624,681	A495V	probably benign	Het
Samd15	A	G	12: 87,200,834	T98A	possibly damaging	Het
Sdk1	T	G	5: 141,582,294	D82E	probably benign	Het
Slc26a7	T	C	4: 14,546,309	D340G	probably benign	Het
Slc6a15	T	A	10: 103,418,060	M619K	probably benign	Het
Slc7a4	C	A	16: 17,574,521	D350Y	probably damaging	Het
Slk	T	G	19: 47,619,956	N449K	probably benign	Het
Spta1	A	T	1: 174,244,042		probably null	Het
Sptbn5	A	T	2: 120,055,893		probably benign	Het
Srd5a2	A	T	17: 74,047,805	V8D	probably benign	Het
Srgap3	G	A	6: 112,727,310	A906V	probably benign	Het
Stab2	A	T	10: 86,947,147	M679K	probably benign	Het
Stk3	T	C	15: 34,999,908	I291V	probably benign	Het
Supt6	T	A	11: 78,208,134	Q1637L	possibly damaging	Het
Svil	T	C	18: 5,114,564	F2047S	probably damaging	Het
Swsap1	A	G	9: 21,955,988	E76G	probably benign	Het
Syndig1	G	T	2: 149,899,553	G20C	probably damaging	Het
Synj2bp	A	T	12: 81,502,152	N104K	probably damaging	Het
Synpo2	T	A	3: 123,114,419	D416V	probably damaging	Het
Tacc3	G	T	5: 33,672,013	C620F	probably damaging	Het
Tanc1	A	G	2: 59,699,422	E19G	probably damaging	Het
Tarsl2	C	T	7: 65,647,554	A139V	probably benign	Het
Tbc1d22a	T	A	15: 86,351,734	C365S	probably damaging	Het
Tdpoz2	T	C	3: 93,652,074	H197R	possibly damaging	Het
Tha1	A	T	11: 117,869,379	N300K	probably damaging	Het
Tm6sf1	T	A	7: 81,865,260	F70L	probably damaging	Het
Tmem132b	T	A	5: 125,783,433	S581T	probably benign	Het
Tmem206	A	T	1: 191,340,843	I154F	probably damaging	Het
Tnfsf13	G	T	11: 69,685,249	S4*	probably null	Het
Tonsl	G	A	15: 76,633,248	S757L	probably benign	Het
Trem2	G	T	17: 48,351,691	R161S	possibly damaging	Het
Trpm2	A	T	10: 77,941,173	V430E	probably damaging	Het
Ttc14	T	A	3: 33,801,369	D154E	possibly damaging	Het
Ugt2b37	T	C	5: 87,250,639	M313V	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,877,394	A107T	probably damaging	Het
Vmn2r24	A	G	6: 123,815,780	I689V	probably benign	Het
Wdr76	A	G	2: 121,542,494	T601A	probably benign	Het
Xirp1	T	C	9: 120,017,003	D938G	possibly damaging	Het
Zfp608	A	T	18: 54,897,969	D966E	probably benign	Het
Zfp957	A	G	14: 79,214,356	M1T	probably null	Het
Zkscan16	A	T	4: 58,957,809	H697L	possibly damaging	Het

Other mutations in Etl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Etl4	APN	2	20766478	missense	possibly damaging	0.81
IGL00944:Etl4	APN	2	20530054	missense	possibly damaging	0.52
IGL01078:Etl4	APN	2	20806531	nonsense	probably null
IGL01099:Etl4	APN	2	20807111	missense	probably benign	0.06
IGL01337:Etl4	APN	2	20785387	missense	probably benign	0.01
IGL01348:Etl4	APN	2	20806973	missense	probably damaging	1.00
IGL01349:Etl4	APN	2	20713396	missense	probably damaging	1.00
IGL01407:Etl4	APN	2	20743856	missense	probably damaging	0.99
IGL01552:Etl4	APN	2	20778189	missense	probably damaging	0.99
IGL01662:Etl4	APN	2	20806649	missense	probably benign	0.04
IGL01687:Etl4	APN	2	20530087	missense	probably damaging	1.00
IGL01793:Etl4	APN	2	20743898	missense	possibly damaging	0.87
IGL01844:Etl4	APN	2	20806682	missense	probably benign	0.06
IGL02025:Etl4	APN	2	20806526	missense	probably damaging	1.00
IGL02088:Etl4	APN	2	20806548	missense	probably damaging	1.00
IGL02134:Etl4	APN	2	20806429	missense	possibly damaging	0.79
IGL02369:Etl4	APN	2	20530189	missense	probably damaging	1.00
IGL02480:Etl4	APN	2	20788524	missense	probably damaging	0.99
IGL02560:Etl4	APN	2	20743718	missense	probably damaging	1.00
IGL02851:Etl4	APN	2	20808029	missense	possibly damaging	0.46
IGL02893:Etl4	APN	2	20760210	splice site	probably benign
IGL02951:Etl4	APN	2	20801537	splice site	probably benign
IGL03119:Etl4	APN	2	20713387	missense	probably damaging	1.00
IGL03267:Etl4	APN	2	20785182	nonsense	probably null
IGL03379:Etl4	APN	2	20662016	missense	possibly damaging	0.87
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0095:Etl4	UTSW	2	20743868	missense	probably damaging	1.00
R0100:Etl4	UTSW	2	20339905	missense	probably benign
R0311:Etl4	UTSW	2	20807129	missense	probably damaging	1.00
R0346:Etl4	UTSW	2	20759652	critical splice donor site	probably null
R0348:Etl4	UTSW	2	20778129	missense	probably damaging	1.00
R0379:Etl4	UTSW	2	20807354	missense	probably damaging	0.98
R0571:Etl4	UTSW	2	20743769	missense	probably damaging	0.99
R0697:Etl4	UTSW	2	20743861	missense	probably damaging	1.00
R0707:Etl4	UTSW	2	20805571	splice site	probably benign
R0980:Etl4	UTSW	2	20801567	missense	probably damaging	1.00
R1120:Etl4	UTSW	2	20806703	missense	probably benign	0.00
R1254:Etl4	UTSW	2	20807923	missense	probably damaging	1.00
R1346:Etl4	UTSW	2	20806144	missense	possibly damaging	0.94
R1460:Etl4	UTSW	2	20788477	missense	probably damaging	1.00
R1503:Etl4	UTSW	2	20743874	missense	possibly damaging	0.94
R1547:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R1627:Etl4	UTSW	2	20801579	missense	possibly damaging	0.91
R1635:Etl4	UTSW	2	20806408	missense	probably damaging	1.00
R1716:Etl4	UTSW	2	20743681	missense	probably damaging	1.00
R1795:Etl4	UTSW	2	20808026	critical splice donor site	probably null
R1885:Etl4	UTSW	2	20743984	missense	probably damaging	1.00
R2039:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R2083:Etl4	UTSW	2	20743549	missense	probably damaging	1.00
R2109:Etl4	UTSW	2	20785342	missense	probably benign	0.27
R2153:Etl4	UTSW	2	20798734	missense	probably benign	0.00
R2403:Etl4	UTSW	2	20807306	nonsense	probably null
R2883:Etl4	UTSW	2	20806174	missense	possibly damaging	0.83
R2985:Etl4	UTSW	2	20781849	missense	probably damaging	1.00
R3402:Etl4	UTSW	2	20781882	missense	probably damaging	1.00
R3696:Etl4	UTSW	2	20801662	critical splice donor site	probably null
R3755:Etl4	UTSW	2	20743537	missense	probably benign	0.10
R3813:Etl4	UTSW	2	20788435	missense	probably damaging	1.00
R3829:Etl4	UTSW	2	20785421	missense	probably benign	0.07
R3887:Etl4	UTSW	2	20529961	nonsense	probably null
R3888:Etl4	UTSW	2	20529961	nonsense	probably null
R3889:Etl4	UTSW	2	20529961	nonsense	probably null
R3958:Etl4	UTSW	2	20340043	missense	probably benign
R3959:Etl4	UTSW	2	20340043	missense	probably benign
R3960:Etl4	UTSW	2	20340043	missense	probably benign
R4058:Etl4	UTSW	2	20806019	missense	possibly damaging	0.59
R4074:Etl4	UTSW	2	20809219	utr 3 prime	probably benign
R4077:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4078:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4127:Etl4	UTSW	2	20744075	missense	possibly damaging	0.93
R4200:Etl4	UTSW	2	20781883	missense	probably damaging	1.00
R4492:Etl4	UTSW	2	20806865	missense	possibly damaging	0.67
R4514:Etl4	UTSW	2	20661898	missense	probably damaging	1.00
R4820:Etl4	UTSW	2	20806685	missense	possibly damaging	0.85
R4888:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R4938:Etl4	UTSW	2	20798649	missense	probably benign	0.00
R4943:Etl4	UTSW	2	20807281	missense	probably benign	0.05
R5121:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R5191:Etl4	UTSW	2	20339999	missense	probably damaging	0.99
R5198:Etl4	UTSW	2	20713387	missense	probably damaging	1.00
R5199:Etl4	UTSW	2	20744042	missense	probably damaging	1.00
R5470:Etl4	UTSW	2	20529980	missense	probably damaging	0.99
R5513:Etl4	UTSW	2	20743827	missense	probably damaging	1.00
R5620:Etl4	UTSW	2	20530226	missense	probably damaging	1.00
R5635:Etl4	UTSW	2	20807035	missense	probably damaging	1.00
R5641:Etl4	UTSW	2	20806462	frame shift	probably null
R5690:Etl4	UTSW	2	20805836	missense	probably benign	0.01
R5784:Etl4	UTSW	2	20806205	missense	possibly damaging	0.79
R5794:Etl4	UTSW	2	20806512	missense	probably damaging	1.00
R5908:Etl4	UTSW	2	20743907	missense	probably damaging	0.96
R5982:Etl4	UTSW	2	20781015	missense	probably damaging	1.00
R6151:Etl4	UTSW	2	20713360	missense	probably damaging	1.00
R6192:Etl4	UTSW	2	20801551	missense	probably damaging	0.98
R6238:Etl4	UTSW	2	20801568	missense	probably damaging	1.00
R6248:Etl4	UTSW	2	20809089	missense	possibly damaging	0.90
R6292:Etl4	UTSW	2	20743573	missense	probably damaging	1.00
R6610:Etl4	UTSW	2	20713369	missense	probably damaging	1.00
R6739:Etl4	UTSW	2	20713435	missense	probably damaging	1.00
R6846:Etl4	UTSW	2	20744108	missense	possibly damaging	0.94
R6863:Etl4	UTSW	2	20806309	missense	probably benign	0.01
R6873:Etl4	UTSW	2	20797992	splice site	probably null
R7003:Etl4	UTSW	2	20805884	missense	probably benign	0.03
R7155:Etl4	UTSW	2	20806931	missense	probably damaging	0.96
R7207:Etl4	UTSW	2	20709576	missense	probably damaging	0.99
R7230:Etl4	UTSW	2	20797988	missense	probably damaging	1.00
R7305:Etl4	UTSW	2	20709557	missense	probably damaging	1.00
R7389:Etl4	UTSW	2	20785093	nonsense	probably null
R7396:Etl4	UTSW	2	20798638	missense	possibly damaging	0.62
R7441:Etl4	UTSW	2	20744189	missense	possibly damaging	0.87
R7626:Etl4	UTSW	2	20713378	missense	probably damaging	1.00
R7776:Etl4	UTSW	2	20807146	missense	probably damaging	0.99
R7779:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R7798:Etl4	UTSW	2	20781946	critical splice donor site	probably null
R7851:Etl4	UTSW	2	20744140	missense	probably damaging	1.00
R7861:Etl4	UTSW	2	20805910	missense	probably benign
R7901:Etl4	UTSW	2	20290010	missense	possibly damaging	0.83
R8053:Etl4	UTSW	2	20661963	missense	probably damaging	1.00
R8124:Etl4	UTSW	2	20806640	missense	probably benign	0.06
R8133:Etl4	UTSW	2	20806271	missense	possibly damaging	0.86
R8203:Etl4	UTSW	2	20785105	missense	possibly damaging	0.61
R8238:Etl4	UTSW	2	20806531	nonsense	probably null
R8263:Etl4	UTSW	2	20744154	missense	probably benign	0.00
R8299:Etl4	UTSW	2	20744063	missense	possibly damaging	0.81
R8318:Etl4	UTSW	2	20788530	missense	probably damaging	1.00
R8334:Etl4	UTSW	2	20781046	missense	probably damaging	0.96
R8443:Etl4	UTSW	2	20806166	missense	probably benign	0.04
R8525:Etl4	UTSW	2	20530081	missense	probably damaging	1.00
R8679:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R8918:Etl4	UTSW	2	20743922	missense	probably benign
R8918:Etl4	UTSW	2	20806435	missense	probably benign	0.00
R9062:Etl4	UTSW	2	20743805	missense	probably damaging	0.99
R9095:Etl4	UTSW	2	20778153	missense	probably damaging	1.00
R9200:Etl4	UTSW	2	20781891	missense	probably damaging	1.00
R9416:Etl4	UTSW	2	20743973	missense	probably benign	0.17
R9437:Etl4	UTSW	2	20809061	missense	probably benign	0.20
R9451:Etl4	UTSW	2	20809115	missense	probably benign	0.03
R9489:Etl4	UTSW	2	20766534	missense	possibly damaging	0.75
R9531:Etl4	UTSW	2	20290007	start codon destroyed	probably null	0.01
R9605:Etl4	UTSW	2	20766534	missense	possibly damaging	0.75
R9623:Etl4	UTSW	2	20806241	missense
R9631:Etl4	UTSW	2	20661938	missense	probably benign	0.28
R9632:Etl4	UTSW	2	20661938	missense	probably benign	0.28
R9646:Etl4	UTSW	2	20797913	missense	probably benign	0.00
R9732:Etl4	UTSW	2	20743562	missense	probably damaging	0.98
R9755:Etl4	UTSW	2	20785237	missense	probably benign	0.17
R9771:Etl4	UTSW	2	20806726	missense	probably benign
RF003:Etl4	UTSW	2	20519918	nonsense	probably null
X0018:Etl4	UTSW	2	20809190	missense	probably damaging	0.98
X0022:Etl4	UTSW	2	20709564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGCTAACTCCAGGAGTGC -3'
(R):5'- AGGCTGTCCAGTGTTCTGTAAG -3'

Sequencing Primer
(F):5'- CTAACTCCAGGAGTGCAGGGG -3'
(R):5'- ATCAGTCCTTGATGCCGGAAG -3'

Posted On

2016-03-01