Incidental Mutation 'R4825:Prex1'
ID 371361
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Name phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms P-REX1
MMRRC Submission 042441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R4825 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166408265-166555752 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 166427777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 788 (C788*)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]
AlphaFold Q69ZK0
Predicted Effect probably null
Transcript: ENSMUST00000036719
AA Change: C958*
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: C958*

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099080
AA Change: C788*
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: C788*

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109246
SMART Domains Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
low complexity region 357 367 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,682,498 (GRCm39) L229F probably benign Het
A930002H24Rik A C 17: 64,170,603 (GRCm39) S62A unknown Het
Abca12 T A 1: 71,341,844 (GRCm39) Q1039L possibly damaging Het
Adgrg5 T A 8: 95,668,362 (GRCm39) F476I possibly damaging Het
Alms1 A G 6: 85,655,227 (GRCm39) K2789E probably damaging Het
Arrdc2 G A 8: 71,291,921 (GRCm39) probably null Het
Atp2b1 T A 10: 98,845,426 (GRCm39) I743K probably damaging Het
Atp6v1c2 C T 12: 17,339,061 (GRCm39) G230D probably benign Het
AU040320 G A 4: 126,685,586 (GRCm39) C54Y probably damaging Het
BC024139 C T 15: 76,004,517 (GRCm39) V680I possibly damaging Het
Bckdhb A G 9: 83,870,958 (GRCm39) D156G probably damaging Het
Bltp3a G A 17: 28,096,368 (GRCm39) A107T probably damaging Het
Canx T A 11: 50,199,636 (GRCm39) D143V probably benign Het
Ccdc180 T A 4: 45,912,794 (GRCm39) V591E possibly damaging Het
Ccno T C 13: 113,124,633 (GRCm39) S68P probably benign Het
Cdc45 C T 16: 18,603,613 (GRCm39) E527K probably damaging Het
Cep290 T A 10: 100,324,210 (GRCm39) D14E probably damaging Het
Cgnl1 A G 9: 71,537,806 (GRCm39) V1238A probably benign Het
Ciz1 C T 2: 32,261,753 (GRCm39) A455V probably damaging Het
Coro2b T A 9: 62,361,905 (GRCm39) Y86F probably benign Het
Csf2ra C T 19: 61,214,990 (GRCm39) R158Q probably benign Het
Cubn A T 2: 13,330,036 (GRCm39) I2615N probably damaging Het
Dhx8 C T 11: 101,628,996 (GRCm39) R129* probably null Het
Disc1 T A 8: 125,862,041 (GRCm39) M471K possibly damaging Het
Dmxl2 G T 9: 54,311,325 (GRCm39) L1799I probably benign Het
Dnah2 A G 11: 69,314,031 (GRCm39) S4108P probably damaging Het
Ecpas G A 4: 58,850,911 (GRCm39) L421F probably damaging Het
Ehmt2 C G 17: 35,125,940 (GRCm39) P211R probably benign Het
Eif4g3 A G 4: 137,921,392 (GRCm39) D1557G probably benign Het
Epha5 T C 5: 84,381,699 (GRCm39) D384G probably damaging Het
Etl4 A G 2: 20,811,738 (GRCm39) I1274V probably damaging Het
Fhip1a G A 3: 85,580,739 (GRCm39) P489S possibly damaging Het
Fip1l1 G A 5: 74,748,866 (GRCm39) probably null Het
Fubp1 T C 3: 151,923,527 (GRCm39) probably null Het
Glul T C 1: 153,778,790 (GRCm39) V33A probably benign Het
Gm4846 A G 1: 166,319,237 (GRCm39) F167S probably damaging Het
Heatr6 T A 11: 83,649,148 (GRCm39) L168M probably damaging Het
Hif1a T A 12: 73,979,175 (GRCm39) I233N probably damaging Het
Hivep2 T A 10: 14,007,063 (GRCm39) H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,292,410 (GRCm39) I9M probably benign Het
Izumo1 T A 7: 45,274,411 (GRCm39) C62* probably null Het
Jakmip3 G A 7: 138,628,495 (GRCm39) E424K probably damaging Het
Klhl2 A G 8: 65,205,847 (GRCm39) V358A probably damaging Het
Klk10 C G 7: 43,433,022 (GRCm39) D139E probably damaging Het
Klk14 T C 7: 43,341,500 (GRCm39) C51R probably damaging Het
Klk1b5 T G 7: 43,494,814 (GRCm39) I99S probably damaging Het
L3hypdh T C 12: 72,124,167 (GRCm39) T258A probably benign Het
Lrp5 A G 19: 3,664,292 (GRCm39) Y812H probably damaging Het
Lrrc40 T A 3: 157,766,967 (GRCm39) L474* probably null Het
Mkks A T 2: 136,722,575 (GRCm39) M194K probably benign Het
Mmp20 A G 9: 7,654,121 (GRCm39) D347G probably damaging Het
Mmp27 A G 9: 7,581,195 (GRCm39) E460G probably damaging Het
Mms22l T C 4: 24,536,226 (GRCm39) F605S probably damaging Het
Mpzl3 A G 9: 44,979,627 (GRCm39) S193G probably benign Het
Muc4 A T 16: 32,570,565 (GRCm39) T542S probably benign Het
Muc5b T C 7: 141,422,202 (GRCm39) L4446P possibly damaging Het
Mxi1 C A 19: 53,358,769 (GRCm39) S131* probably null Het
Nanog G T 6: 122,690,299 (GRCm39) A210S probably benign Het
Nrcam C T 12: 44,622,769 (GRCm39) Q988* probably null Het
Nsg1 C A 5: 38,316,391 (GRCm39) probably benign Het
Ogfod3 G A 11: 121,086,027 (GRCm39) A189V probably benign Het
Or10g9b A T 9: 39,918,038 (GRCm39) M69K possibly damaging Het
Or12e9 T A 2: 87,202,432 (GRCm39) C185* probably null Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c122 T C 2: 89,079,034 (GRCm39) probably null Het
Or4c35 G A 2: 89,808,497 (GRCm39) C125Y probably damaging Het
Or51ai2 T C 7: 103,586,710 (GRCm39) V41A probably benign Het
Or52b4i T A 7: 102,191,587 (GRCm39) V148E possibly damaging Het
Or5b111 A T 19: 13,291,684 (GRCm39) probably null Het
Or7e165 T G 9: 19,694,872 (GRCm39) S148A possibly damaging Het
Or8b53 A T 9: 38,667,703 (GRCm39) T240S probably damaging Het
Orc3 A T 4: 34,571,774 (GRCm39) M665K possibly damaging Het
Pabpc1 A G 15: 36,597,255 (GRCm39) S591P probably damaging Het
Pacc1 A T 1: 191,073,040 (GRCm39) I154F probably damaging Het
Parp6 T A 9: 59,531,645 (GRCm39) probably null Het
Pcdh1 T C 18: 38,322,912 (GRCm39) M974V possibly damaging Het
Pcdhb22 T A 18: 37,653,713 (GRCm39) V727E possibly damaging Het
Pex5l T C 3: 33,047,134 (GRCm39) E272G probably damaging Het
Pglyrp2 G T 17: 32,637,235 (GRCm39) N264K probably benign Het
Phxr4 T A 9: 13,342,882 (GRCm39) probably benign Het
Piezo2 A G 18: 63,278,025 (GRCm39) F293S probably damaging Het
Pkhd1 T C 1: 20,607,625 (GRCm39) D1077G probably damaging Het
Plekhs1 A G 19: 56,461,700 (GRCm39) probably null Het
Prrt3 A T 6: 113,475,099 (GRCm39) M41K probably benign Het
Ptgir T C 7: 16,642,768 (GRCm39) V326A probably damaging Het
Ptprg T A 14: 12,220,654 (GRCm38) D455E probably damaging Het
Ptpru T A 4: 131,526,914 (GRCm39) Q686L probably benign Het
Pxdc1 G T 13: 34,814,343 (GRCm39) T190K probably benign Het
Rap1b A T 10: 117,654,487 (GRCm39) C118S probably benign Het
Rapgef2 T C 3: 78,990,534 (GRCm39) M915V probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpe65 C T 3: 159,330,318 (GRCm39) A495V probably benign Het
Samd15 A G 12: 87,247,608 (GRCm39) T98A possibly damaging Het
Sdk1 T G 5: 141,568,049 (GRCm39) D82E probably benign Het
Slc26a7 T C 4: 14,546,309 (GRCm39) D340G probably benign Het
Slc6a15 T A 10: 103,253,921 (GRCm39) M619K probably benign Het
Slc7a4 C A 16: 17,392,385 (GRCm39) D350Y probably damaging Het
Slk T G 19: 47,608,395 (GRCm39) N449K probably benign Het
Spta1 A T 1: 174,071,608 (GRCm39) probably null Het
Sptbn5 A T 2: 119,886,374 (GRCm39) probably benign Het
Srd5a2 A T 17: 74,354,800 (GRCm39) V8D probably benign Het
Srgap3 G A 6: 112,704,271 (GRCm39) A906V probably benign Het
Stab2 A T 10: 86,783,011 (GRCm39) M679K probably benign Het
Stk3 T C 15: 35,000,054 (GRCm39) I291V probably benign Het
Supt6 T A 11: 78,098,960 (GRCm39) Q1637L possibly damaging Het
Svil T C 18: 5,114,564 (GRCm39) F2047S probably damaging Het
Swsap1 A G 9: 21,867,284 (GRCm39) E76G probably benign Het
Syndig1 G T 2: 149,741,473 (GRCm39) G20C probably damaging Het
Synj2bp A T 12: 81,548,926 (GRCm39) N104K probably damaging Het
Synpo2 T A 3: 122,908,068 (GRCm39) D416V probably damaging Het
Tacc3 G T 5: 33,829,357 (GRCm39) C620F probably damaging Het
Tanc1 A G 2: 59,529,766 (GRCm39) E19G probably damaging Het
Tars3 C T 7: 65,297,302 (GRCm39) A139V probably benign Het
Tbc1d22a T A 15: 86,235,935 (GRCm39) C365S probably damaging Het
Tdpoz2 T C 3: 93,559,381 (GRCm39) H197R possibly damaging Het
Tha1 A T 11: 117,760,205 (GRCm39) N300K probably damaging Het
Tm6sf1 T A 7: 81,515,008 (GRCm39) F70L probably damaging Het
Tmem132b T A 5: 125,860,497 (GRCm39) S581T probably benign Het
Tnfsf13 G T 11: 69,576,075 (GRCm39) S4* probably null Het
Tonsl G A 15: 76,517,448 (GRCm39) S757L probably benign Het
Trem2 G T 17: 48,658,719 (GRCm39) R161S possibly damaging Het
Trpm2 A T 10: 77,777,007 (GRCm39) V430E probably damaging Het
Ttc14 T A 3: 33,855,518 (GRCm39) D154E possibly damaging Het
Ugt2b37 T C 5: 87,398,498 (GRCm39) M313V possibly damaging Het
Vmn2r24 A G 6: 123,792,739 (GRCm39) I689V probably benign Het
Wdr76 A G 2: 121,372,975 (GRCm39) T601A probably benign Het
Xirp1 T C 9: 119,846,069 (GRCm39) D938G possibly damaging Het
Zfp608 A T 18: 55,031,041 (GRCm39) D966E probably benign Het
Zfp957 A G 14: 79,451,796 (GRCm39) M1T probably null Het
Zkscan16 A T 4: 58,957,809 (GRCm39) H697L possibly damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166,480,321 (GRCm39) missense probably damaging 1.00
IGL00309:Prex1 APN 2 166,451,743 (GRCm39) missense probably damaging 0.99
IGL00953:Prex1 APN 2 166,480,329 (GRCm39) missense probably damaging 1.00
IGL00961:Prex1 APN 2 166,427,656 (GRCm39) missense probably damaging 0.98
IGL01300:Prex1 APN 2 166,480,327 (GRCm39) missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166,411,260 (GRCm39) splice site probably benign
IGL01753:Prex1 APN 2 166,444,802 (GRCm39) missense probably benign 0.11
IGL01819:Prex1 APN 2 166,463,165 (GRCm39) missense probably damaging 1.00
IGL02058:Prex1 APN 2 166,427,103 (GRCm39) missense probably benign 0.00
IGL02251:Prex1 APN 2 166,419,806 (GRCm39) missense probably damaging 0.99
IGL02326:Prex1 APN 2 166,463,105 (GRCm39) missense probably benign 0.35
IGL02366:Prex1 APN 2 166,422,347 (GRCm39) missense probably damaging 1.00
IGL02414:Prex1 APN 2 166,451,748 (GRCm39) missense probably damaging 1.00
IGL02660:Prex1 APN 2 166,435,787 (GRCm39) missense probably damaging 0.97
IGL02666:Prex1 APN 2 166,414,909 (GRCm39) missense probably benign 0.00
IGL02874:Prex1 APN 2 166,426,967 (GRCm39) missense probably damaging 1.00
IGL02935:Prex1 APN 2 166,412,265 (GRCm39) missense probably damaging 1.00
IGL03179:Prex1 APN 2 166,427,114 (GRCm39) missense probably benign 0.31
R0207:Prex1 UTSW 2 166,427,818 (GRCm39) missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166,428,619 (GRCm39) unclassified probably benign
R0420:Prex1 UTSW 2 166,431,491 (GRCm39) missense probably benign 0.13
R0449:Prex1 UTSW 2 166,411,297 (GRCm39) missense probably benign 0.16
R0458:Prex1 UTSW 2 166,427,743 (GRCm39) missense probably damaging 0.99
R0927:Prex1 UTSW 2 166,428,457 (GRCm39) missense probably benign 0.01
R1299:Prex1 UTSW 2 166,427,827 (GRCm39) missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166,435,781 (GRCm39) missense probably damaging 1.00
R1440:Prex1 UTSW 2 166,422,383 (GRCm39) missense probably damaging 0.98
R1506:Prex1 UTSW 2 166,429,001 (GRCm39) missense probably damaging 1.00
R1725:Prex1 UTSW 2 166,443,656 (GRCm39) missense probably damaging 1.00
R1831:Prex1 UTSW 2 166,427,021 (GRCm39) missense probably damaging 1.00
R1883:Prex1 UTSW 2 166,425,192 (GRCm39) missense probably benign 0.20
R1896:Prex1 UTSW 2 166,428,574 (GRCm39) missense probably benign 0.01
R2022:Prex1 UTSW 2 166,417,534 (GRCm39) missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166,411,285 (GRCm39) missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166,429,077 (GRCm39) missense probably benign 0.00
R2263:Prex1 UTSW 2 166,430,988 (GRCm39) splice site probably benign
R2276:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2279:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2680:Prex1 UTSW 2 166,443,692 (GRCm39) missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166,430,956 (GRCm39) missense probably benign 0.04
R3421:Prex1 UTSW 2 166,459,774 (GRCm39) missense probably damaging 1.00
R3614:Prex1 UTSW 2 166,451,701 (GRCm39) missense probably damaging 1.00
R4244:Prex1 UTSW 2 166,412,256 (GRCm39) missense probably damaging 1.00
R4605:Prex1 UTSW 2 166,555,464 (GRCm39) missense probably benign 0.45
R4685:Prex1 UTSW 2 166,480,252 (GRCm39) missense probably damaging 0.97
R4787:Prex1 UTSW 2 166,480,260 (GRCm39) missense probably benign 0.01
R4796:Prex1 UTSW 2 166,434,211 (GRCm39) missense probably damaging 1.00
R4955:Prex1 UTSW 2 166,415,143 (GRCm39) missense probably damaging 0.99
R5046:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R5095:Prex1 UTSW 2 166,423,841 (GRCm39) missense probably damaging 1.00
R5408:Prex1 UTSW 2 166,417,573 (GRCm39) small insertion probably benign
R5462:Prex1 UTSW 2 166,486,728 (GRCm39) missense probably benign 0.02
R5535:Prex1 UTSW 2 166,422,193 (GRCm39) missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166,428,579 (GRCm39) missense probably damaging 1.00
R5813:Prex1 UTSW 2 166,425,127 (GRCm39) missense probably benign
R5860:Prex1 UTSW 2 166,486,604 (GRCm39) intron probably benign
R5984:Prex1 UTSW 2 166,427,664 (GRCm39) missense probably damaging 1.00
R6009:Prex1 UTSW 2 166,423,904 (GRCm39) missense probably damaging 1.00
R6174:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R6345:Prex1 UTSW 2 166,414,880 (GRCm39) missense probably null 0.81
R6897:Prex1 UTSW 2 166,423,913 (GRCm39) missense probably damaging 0.99
R6935:Prex1 UTSW 2 166,441,575 (GRCm39) missense probably damaging 1.00
R7025:Prex1 UTSW 2 166,455,107 (GRCm39) small insertion probably benign
R7037:Prex1 UTSW 2 166,429,100 (GRCm39) missense probably benign 0.05
R7076:Prex1 UTSW 2 166,475,302 (GRCm39) missense probably damaging 0.99
R7181:Prex1 UTSW 2 166,412,291 (GRCm39) missense probably damaging 1.00
R7361:Prex1 UTSW 2 166,555,490 (GRCm39) missense probably benign 0.04
R7381:Prex1 UTSW 2 166,429,047 (GRCm39) missense probably damaging 1.00
R7721:Prex1 UTSW 2 166,419,810 (GRCm39) nonsense probably null
R7763:Prex1 UTSW 2 166,555,629 (GRCm39) missense unknown
R7809:Prex1 UTSW 2 166,415,164 (GRCm39) missense possibly damaging 0.91
R7915:Prex1 UTSW 2 166,463,112 (GRCm39) missense probably damaging 1.00
R7971:Prex1 UTSW 2 166,423,859 (GRCm39) missense probably damaging 1.00
R7998:Prex1 UTSW 2 166,428,965 (GRCm39) critical splice donor site probably null
R8029:Prex1 UTSW 2 166,417,523 (GRCm39) missense probably benign 0.01
R8193:Prex1 UTSW 2 166,435,780 (GRCm39) missense possibly damaging 0.60
R8352:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8452:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8927:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R8928:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R9021:Prex1 UTSW 2 166,432,429 (GRCm39) missense possibly damaging 0.47
R9070:Prex1 UTSW 2 166,427,707 (GRCm39) missense probably damaging 1.00
R9213:Prex1 UTSW 2 166,417,669 (GRCm39) missense probably damaging 0.99
R9511:Prex1 UTSW 2 166,413,481 (GRCm39) missense probably damaging 1.00
R9514:Prex1 UTSW 2 166,419,896 (GRCm39) missense possibly damaging 0.53
R9529:Prex1 UTSW 2 166,431,518 (GRCm39) missense probably damaging 1.00
X0065:Prex1 UTSW 2 166,428,545 (GRCm39) missense probably benign
Z1176:Prex1 UTSW 2 166,414,890 (GRCm39) nonsense probably null
Z1177:Prex1 UTSW 2 166,434,148 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTGTAAGGTGAGCTCTAACAC -3'
(R):5'- CAGGGTGACAGCTTCATTCACAG -3'

Sequencing Primer
(F):5'- GGTGAGCTCTAACACAAGTTCTG -3'
(R):5'- CCGATTTGGGAGTGTCAGGACTAC -3'
Posted On 2016-03-01