Incidental Mutation 'R4825:Tdpoz2'
ID 371366
Institutional Source Beutler Lab
Gene Symbol Tdpoz2
Ensembl Gene ENSMUSG00000103362
Gene Name TD and POZ domain containing 2
Synonyms
MMRRC Submission 042441-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R4825 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 93558849-93559993 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93559381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 197 (H197R)
Ref Sequence ENSEMBL: ENSMUSP00000141299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191960]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000191960
AA Change: H197R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141299
Gene: ENSMUSG00000103362
AA Change: H197R

DomainStartEndE-ValueType
MATH 24 130 1.27e-6 SMART
BTB 188 287 7.44e-24 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,682,498 (GRCm39) L229F probably benign Het
A930002H24Rik A C 17: 64,170,603 (GRCm39) S62A unknown Het
Abca12 T A 1: 71,341,844 (GRCm39) Q1039L possibly damaging Het
Adgrg5 T A 8: 95,668,362 (GRCm39) F476I possibly damaging Het
Alms1 A G 6: 85,655,227 (GRCm39) K2789E probably damaging Het
Arrdc2 G A 8: 71,291,921 (GRCm39) probably null Het
Atp2b1 T A 10: 98,845,426 (GRCm39) I743K probably damaging Het
Atp6v1c2 C T 12: 17,339,061 (GRCm39) G230D probably benign Het
AU040320 G A 4: 126,685,586 (GRCm39) C54Y probably damaging Het
BC024139 C T 15: 76,004,517 (GRCm39) V680I possibly damaging Het
Bckdhb A G 9: 83,870,958 (GRCm39) D156G probably damaging Het
Bltp3a G A 17: 28,096,368 (GRCm39) A107T probably damaging Het
Canx T A 11: 50,199,636 (GRCm39) D143V probably benign Het
Ccdc180 T A 4: 45,912,794 (GRCm39) V591E possibly damaging Het
Ccno T C 13: 113,124,633 (GRCm39) S68P probably benign Het
Cdc45 C T 16: 18,603,613 (GRCm39) E527K probably damaging Het
Cep290 T A 10: 100,324,210 (GRCm39) D14E probably damaging Het
Cgnl1 A G 9: 71,537,806 (GRCm39) V1238A probably benign Het
Ciz1 C T 2: 32,261,753 (GRCm39) A455V probably damaging Het
Coro2b T A 9: 62,361,905 (GRCm39) Y86F probably benign Het
Csf2ra C T 19: 61,214,990 (GRCm39) R158Q probably benign Het
Cubn A T 2: 13,330,036 (GRCm39) I2615N probably damaging Het
Dhx8 C T 11: 101,628,996 (GRCm39) R129* probably null Het
Disc1 T A 8: 125,862,041 (GRCm39) M471K possibly damaging Het
Dmxl2 G T 9: 54,311,325 (GRCm39) L1799I probably benign Het
Dnah2 A G 11: 69,314,031 (GRCm39) S4108P probably damaging Het
Ecpas G A 4: 58,850,911 (GRCm39) L421F probably damaging Het
Ehmt2 C G 17: 35,125,940 (GRCm39) P211R probably benign Het
Eif4g3 A G 4: 137,921,392 (GRCm39) D1557G probably benign Het
Epha5 T C 5: 84,381,699 (GRCm39) D384G probably damaging Het
Etl4 A G 2: 20,811,738 (GRCm39) I1274V probably damaging Het
Fhip1a G A 3: 85,580,739 (GRCm39) P489S possibly damaging Het
Fip1l1 G A 5: 74,748,866 (GRCm39) probably null Het
Fubp1 T C 3: 151,923,527 (GRCm39) probably null Het
Glul T C 1: 153,778,790 (GRCm39) V33A probably benign Het
Gm4846 A G 1: 166,319,237 (GRCm39) F167S probably damaging Het
Heatr6 T A 11: 83,649,148 (GRCm39) L168M probably damaging Het
Hif1a T A 12: 73,979,175 (GRCm39) I233N probably damaging Het
Hivep2 T A 10: 14,007,063 (GRCm39) H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,292,410 (GRCm39) I9M probably benign Het
Izumo1 T A 7: 45,274,411 (GRCm39) C62* probably null Het
Jakmip3 G A 7: 138,628,495 (GRCm39) E424K probably damaging Het
Klhl2 A G 8: 65,205,847 (GRCm39) V358A probably damaging Het
Klk10 C G 7: 43,433,022 (GRCm39) D139E probably damaging Het
Klk14 T C 7: 43,341,500 (GRCm39) C51R probably damaging Het
Klk1b5 T G 7: 43,494,814 (GRCm39) I99S probably damaging Het
L3hypdh T C 12: 72,124,167 (GRCm39) T258A probably benign Het
Lrp5 A G 19: 3,664,292 (GRCm39) Y812H probably damaging Het
Lrrc40 T A 3: 157,766,967 (GRCm39) L474* probably null Het
Mkks A T 2: 136,722,575 (GRCm39) M194K probably benign Het
Mmp20 A G 9: 7,654,121 (GRCm39) D347G probably damaging Het
Mmp27 A G 9: 7,581,195 (GRCm39) E460G probably damaging Het
Mms22l T C 4: 24,536,226 (GRCm39) F605S probably damaging Het
Mpzl3 A G 9: 44,979,627 (GRCm39) S193G probably benign Het
Muc4 A T 16: 32,570,565 (GRCm39) T542S probably benign Het
Muc5b T C 7: 141,422,202 (GRCm39) L4446P possibly damaging Het
Mxi1 C A 19: 53,358,769 (GRCm39) S131* probably null Het
Nanog G T 6: 122,690,299 (GRCm39) A210S probably benign Het
Nrcam C T 12: 44,622,769 (GRCm39) Q988* probably null Het
Nsg1 C A 5: 38,316,391 (GRCm39) probably benign Het
Ogfod3 G A 11: 121,086,027 (GRCm39) A189V probably benign Het
Or10g9b A T 9: 39,918,038 (GRCm39) M69K possibly damaging Het
Or12e9 T A 2: 87,202,432 (GRCm39) C185* probably null Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c122 T C 2: 89,079,034 (GRCm39) probably null Het
Or4c35 G A 2: 89,808,497 (GRCm39) C125Y probably damaging Het
Or51ai2 T C 7: 103,586,710 (GRCm39) V41A probably benign Het
Or52b4i T A 7: 102,191,587 (GRCm39) V148E possibly damaging Het
Or5b111 A T 19: 13,291,684 (GRCm39) probably null Het
Or7e165 T G 9: 19,694,872 (GRCm39) S148A possibly damaging Het
Or8b53 A T 9: 38,667,703 (GRCm39) T240S probably damaging Het
Orc3 A T 4: 34,571,774 (GRCm39) M665K possibly damaging Het
Pabpc1 A G 15: 36,597,255 (GRCm39) S591P probably damaging Het
Pacc1 A T 1: 191,073,040 (GRCm39) I154F probably damaging Het
Parp6 T A 9: 59,531,645 (GRCm39) probably null Het
Pcdh1 T C 18: 38,322,912 (GRCm39) M974V possibly damaging Het
Pcdhb22 T A 18: 37,653,713 (GRCm39) V727E possibly damaging Het
Pex5l T C 3: 33,047,134 (GRCm39) E272G probably damaging Het
Pglyrp2 G T 17: 32,637,235 (GRCm39) N264K probably benign Het
Phxr4 T A 9: 13,342,882 (GRCm39) probably benign Het
Piezo2 A G 18: 63,278,025 (GRCm39) F293S probably damaging Het
Pkhd1 T C 1: 20,607,625 (GRCm39) D1077G probably damaging Het
Plekhs1 A G 19: 56,461,700 (GRCm39) probably null Het
Prex1 G T 2: 166,427,777 (GRCm39) C788* probably null Het
Prrt3 A T 6: 113,475,099 (GRCm39) M41K probably benign Het
Ptgir T C 7: 16,642,768 (GRCm39) V326A probably damaging Het
Ptprg T A 14: 12,220,654 (GRCm38) D455E probably damaging Het
Ptpru T A 4: 131,526,914 (GRCm39) Q686L probably benign Het
Pxdc1 G T 13: 34,814,343 (GRCm39) T190K probably benign Het
Rap1b A T 10: 117,654,487 (GRCm39) C118S probably benign Het
Rapgef2 T C 3: 78,990,534 (GRCm39) M915V probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpe65 C T 3: 159,330,318 (GRCm39) A495V probably benign Het
Samd15 A G 12: 87,247,608 (GRCm39) T98A possibly damaging Het
Sdk1 T G 5: 141,568,049 (GRCm39) D82E probably benign Het
Slc26a7 T C 4: 14,546,309 (GRCm39) D340G probably benign Het
Slc6a15 T A 10: 103,253,921 (GRCm39) M619K probably benign Het
Slc7a4 C A 16: 17,392,385 (GRCm39) D350Y probably damaging Het
Slk T G 19: 47,608,395 (GRCm39) N449K probably benign Het
Spta1 A T 1: 174,071,608 (GRCm39) probably null Het
Sptbn5 A T 2: 119,886,374 (GRCm39) probably benign Het
Srd5a2 A T 17: 74,354,800 (GRCm39) V8D probably benign Het
Srgap3 G A 6: 112,704,271 (GRCm39) A906V probably benign Het
Stab2 A T 10: 86,783,011 (GRCm39) M679K probably benign Het
Stk3 T C 15: 35,000,054 (GRCm39) I291V probably benign Het
Supt6 T A 11: 78,098,960 (GRCm39) Q1637L possibly damaging Het
Svil T C 18: 5,114,564 (GRCm39) F2047S probably damaging Het
Swsap1 A G 9: 21,867,284 (GRCm39) E76G probably benign Het
Syndig1 G T 2: 149,741,473 (GRCm39) G20C probably damaging Het
Synj2bp A T 12: 81,548,926 (GRCm39) N104K probably damaging Het
Synpo2 T A 3: 122,908,068 (GRCm39) D416V probably damaging Het
Tacc3 G T 5: 33,829,357 (GRCm39) C620F probably damaging Het
Tanc1 A G 2: 59,529,766 (GRCm39) E19G probably damaging Het
Tars3 C T 7: 65,297,302 (GRCm39) A139V probably benign Het
Tbc1d22a T A 15: 86,235,935 (GRCm39) C365S probably damaging Het
Tha1 A T 11: 117,760,205 (GRCm39) N300K probably damaging Het
Tm6sf1 T A 7: 81,515,008 (GRCm39) F70L probably damaging Het
Tmem132b T A 5: 125,860,497 (GRCm39) S581T probably benign Het
Tnfsf13 G T 11: 69,576,075 (GRCm39) S4* probably null Het
Tonsl G A 15: 76,517,448 (GRCm39) S757L probably benign Het
Trem2 G T 17: 48,658,719 (GRCm39) R161S possibly damaging Het
Trpm2 A T 10: 77,777,007 (GRCm39) V430E probably damaging Het
Ttc14 T A 3: 33,855,518 (GRCm39) D154E possibly damaging Het
Ugt2b37 T C 5: 87,398,498 (GRCm39) M313V possibly damaging Het
Vmn2r24 A G 6: 123,792,739 (GRCm39) I689V probably benign Het
Wdr76 A G 2: 121,372,975 (GRCm39) T601A probably benign Het
Xirp1 T C 9: 119,846,069 (GRCm39) D938G possibly damaging Het
Zfp608 A T 18: 55,031,041 (GRCm39) D966E probably benign Het
Zfp957 A G 14: 79,451,796 (GRCm39) M1T probably null Het
Zkscan16 A T 4: 58,957,809 (GRCm39) H697L possibly damaging Het
Other mutations in Tdpoz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Tdpoz2 APN 3 93,559,735 (GRCm39) missense possibly damaging 0.48
IGL02285:Tdpoz2 APN 3 93,559,598 (GRCm39) missense probably damaging 1.00
IGL02350:Tdpoz2 APN 3 93,559,735 (GRCm39) missense possibly damaging 0.48
IGL02357:Tdpoz2 APN 3 93,559,735 (GRCm39) missense possibly damaging 0.48
IGL02887:Tdpoz2 APN 3 93,559,046 (GRCm39) missense probably benign 0.43
FR4304:Tdpoz2 UTSW 3 93,558,922 (GRCm39) frame shift probably null
FR4340:Tdpoz2 UTSW 3 93,558,922 (GRCm39) frame shift probably null
R1502:Tdpoz2 UTSW 3 93,559,453 (GRCm39) missense probably benign 0.01
R1943:Tdpoz2 UTSW 3 93,559,230 (GRCm39) nonsense probably null
R5055:Tdpoz2 UTSW 3 93,559,235 (GRCm39) missense probably damaging 1.00
R5096:Tdpoz2 UTSW 3 93,559,819 (GRCm39) missense possibly damaging 0.87
R5398:Tdpoz2 UTSW 3 93,559,441 (GRCm39) missense probably damaging 0.97
R6178:Tdpoz2 UTSW 3 93,559,618 (GRCm39) missense probably benign 0.01
R6280:Tdpoz2 UTSW 3 93,559,190 (GRCm39) missense probably benign 0.03
R6338:Tdpoz2 UTSW 3 93,559,643 (GRCm39) missense probably benign 0.30
R6544:Tdpoz2 UTSW 3 93,559,267 (GRCm39) missense possibly damaging 0.81
R6954:Tdpoz2 UTSW 3 93,559,582 (GRCm39) missense probably damaging 1.00
R7351:Tdpoz2 UTSW 3 93,559,900 (GRCm39) nonsense probably null
R8473:Tdpoz2 UTSW 3 93,559,153 (GRCm39) missense probably damaging 0.98
R8673:Tdpoz2 UTSW 3 93,558,918 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTTGTCAGCAGCTGCCAG -3'
(R):5'- GGCTTCTACCTAAAGACAAGCTC -3'

Sequencing Primer
(F):5'- CACATCACAGGCCATGGAGTG -3'
(R):5'- TCACCCTCTGCTGCAAGGTG -3'
Posted On 2016-03-01