Mutagenetix > Incidental Mutation

Incidental Mutation 'R4825:Eif4g3'

371381

Institutional Source

Beutler Lab

Gene Symbol

Eif4g3

Ensembl Gene

ENSMUSG00000028760

Gene Name

eukaryotic translation initiation factor 4 gamma, 3

Synonyms

1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII

MMRRC Submission

042441-MU

Accession Numbers

Genbank: NM_172703; MGI: 1923935

Essential gene?

Possibly non essential (E-score: 0.437) question?

Stock #

R4825 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

137993022-138208508 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138194081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1557 (D1557G)

Ref Sequence

ENSEMBL: ENSMUSP00000145147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084214
AA Change: D1373G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: D1373G

Domain	Start	End	E-Value	Type
low complexity region	24	43	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
low complexity region	147	152	N/A	INTRINSIC
PDB:1LJ2\|D	154	179	8e-9	PDB
low complexity region	192	207	N/A	INTRINSIC
low complexity region	269	310	N/A	INTRINSIC
low complexity region	427	444	N/A	INTRINSIC
low complexity region	534	550	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	592	616	N/A	INTRINSIC
Blast:MIF4G	617	708	5e-49	BLAST
Blast:MIF4G	722	765	5e-16	BLAST
MIF4G	768	996	1.42e-65	SMART
low complexity region	1086	1109	N/A	INTRINSIC
MA3	1215	1327	9.29e-38	SMART
eIF5C	1487	1574	7.92e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084215
AA Change: D1374G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: D1374G

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
low complexity region	75	102	N/A	INTRINSIC
low complexity region	129	134	N/A	INTRINSIC
PDB:1LJ2\|D	136	161	8e-9	PDB
low complexity region	174	189	N/A	INTRINSIC
low complexity region	251	292	N/A	INTRINSIC
low complexity region	409	426	N/A	INTRINSIC
low complexity region	516	532	N/A	INTRINSIC
low complexity region	561	570	N/A	INTRINSIC
low complexity region	574	598	N/A	INTRINSIC
Blast:MIF4G	599	690	4e-49	BLAST
Blast:MIF4G	704	747	5e-16	BLAST
MIF4G	750	978	1.42e-65	SMART
low complexity region	1068	1113	N/A	INTRINSIC
MA3	1216	1328	9.29e-38	SMART
eIF5C	1488	1575	7.92e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105831
AA Change: D1362G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: D1362G

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
low complexity region	82	109	N/A	INTRINSIC
low complexity region	136	141	N/A	INTRINSIC
PDB:1LJ2\|D	143	168	8e-9	PDB
low complexity region	181	196	N/A	INTRINSIC
low complexity region	258	299	N/A	INTRINSIC
low complexity region	416	433	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
low complexity region	581	605	N/A	INTRINSIC
Blast:MIF4G	606	697	4e-49	BLAST
Blast:MIF4G	711	754	5e-16	BLAST
MIF4G	757	985	1.42e-65	SMART
low complexity region	1075	1098	N/A	INTRINSIC
MA3	1204	1316	9.29e-38	SMART
eIF5C	1476	1563	7.92e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133902

Predicted Effect

probably benign
Transcript: ENSMUST00000140796
AA Change: D797G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: D797G

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
low complexity region	16	40	N/A	INTRINSIC
Blast:MIF4G	41	132	2e-49	BLAST
Blast:MIF4G	146	189	3e-16	BLAST
MIF4G	192	420	1.42e-65	SMART
low complexity region	510	533	N/A	INTRINSIC
MA3	639	751	9.29e-38	SMART
eIF5C	911	998	7.92e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203828
AA Change: D1557G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: D1557G

Domain	Start	End	E-Value	Type
low complexity region	41	81	N/A	INTRINSIC
low complexity region	193	208	N/A	INTRINSIC
low complexity region	258	285	N/A	INTRINSIC
low complexity region	312	317	N/A	INTRINSIC
PDB:1LJ2\|D	319	344	9e-9	PDB
low complexity region	357	372	N/A	INTRINSIC
low complexity region	434	475	N/A	INTRINSIC
low complexity region	592	609	N/A	INTRINSIC
low complexity region	699	715	N/A	INTRINSIC
low complexity region	744	753	N/A	INTRINSIC
low complexity region	757	781	N/A	INTRINSIC
Blast:MIF4G	782	873	9e-49	BLAST
Blast:MIF4G	887	930	5e-16	BLAST
MIF4G	933	1161	6e-68	SMART
coiled coil region	1174	1201	N/A	INTRINSIC
low complexity region	1251	1296	N/A	INTRINSIC
MA3	1399	1511	3.9e-40	SMART
eIF5C	1671	1758	3.9e-38	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]

Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	A	11: 109,791,672	L229F	probably benign	Het
A930002H24Rik	A	C	17: 63,863,608	S62A	unknown	Het
Abca12	T	A	1: 71,302,685	Q1039L	possibly damaging	Het
Adgrg5	T	A	8: 94,941,734	F476I	possibly damaging	Het
AI314180	G	A	4: 58,850,911	L421F	probably damaging	Het
Alms1	A	G	6: 85,678,245	K2789E	probably damaging	Het
Arrdc2	G	A	8: 70,839,277		probably null	Het
Atp2b1	T	A	10: 99,009,564	I743K	probably damaging	Het
Atp6v1c2	C	T	12: 17,289,060	G230D	probably benign	Het
AU040320	G	A	4: 126,791,793	C54Y	probably damaging	Het
BC024139	C	T	15: 76,120,317	V680I	possibly damaging	Het
Bckdhb	A	G	9: 83,988,905	D156G	probably damaging	Het
Canx	T	A	11: 50,308,809	D143V	probably benign	Het
Ccdc180	T	A	4: 45,912,794	V591E	possibly damaging	Het
Ccno	T	C	13: 112,988,099	S68P	probably benign	Het
Cdc45	C	T	16: 18,784,863	E527K	probably damaging	Het
Cep290	T	A	10: 100,488,348	D14E	probably damaging	Het
Cgnl1	A	G	9: 71,630,524	V1238A	probably benign	Het
Ciz1	C	T	2: 32,371,741	A455V	probably damaging	Het
Coro2b	T	A	9: 62,454,623	Y86F	probably benign	Het
Csf2ra	C	T	19: 61,226,552	R158Q	probably benign	Het
Cubn	A	T	2: 13,325,225	I2615N	probably damaging	Het
Dhx8	C	T	11: 101,738,170	R129*	probably null	Het
Disc1	T	A	8: 125,135,302	M471K	possibly damaging	Het
Dmxl2	G	T	9: 54,404,041	L1799I	probably benign	Het
Dnah2	A	G	11: 69,423,205	S4108P	probably damaging	Het
Ehmt2	C	G	17: 34,906,964	P211R	probably benign	Het
Epha5	T	C	5: 84,233,840	D384G	probably damaging	Het
Etl4	A	G	2: 20,806,927	I1274V	probably damaging	Het
Fam160a1	G	A	3: 85,673,432	P489S	possibly damaging	Het
Fip1l1	G	A	5: 74,588,205		probably null	Het
Fubp1	T	C	3: 152,217,890		probably null	Het
Glul	T	C	1: 153,903,044	V33A	probably benign	Het
Gm4846	A	G	1: 166,491,668	F167S	probably damaging	Het
Heatr6	T	A	11: 83,758,322	L168M	probably damaging	Het
Hif1a	T	A	12: 73,932,401	I233N	probably damaging	Het
Hivep2	T	A	10: 14,131,319	H1220Q	possibly damaging	Het
Igkv8-21	T	C	6: 70,315,426	I9M	probably benign	Het
Izumo1	T	A	7: 45,624,987	C62*	probably null	Het
Jakmip3	G	A	7: 139,026,766	E424K	probably damaging	Het
Klhl2	A	G	8: 64,752,813	V358A	probably damaging	Het
Klk10	C	G	7: 43,783,598	D139E	probably damaging	Het
Klk14	T	C	7: 43,692,076	C51R	probably damaging	Het
Klk5	T	G	7: 43,845,390	I99S	probably damaging	Het
L3hypdh	T	C	12: 72,077,393	T258A	probably benign	Het
Lrp5	A	G	19: 3,614,292	Y812H	probably damaging	Het
Lrrc40	T	A	3: 158,061,330	L474*	probably null	Het
Mkks	A	T	2: 136,880,655	M194K	probably benign	Het
Mmp20	A	G	9: 7,654,120	D347G	probably damaging	Het
Mmp27	A	G	9: 7,581,194	E460G	probably damaging	Het
Mms22l	T	C	4: 24,536,226	F605S	probably damaging	Het
Mpzl3	A	G	9: 45,068,329	S193G	probably benign	Het
Muc4	A	T	16: 32,751,747	T542S	probably benign	Het
Muc5b	T	C	7: 141,868,465	L4446P	possibly damaging	Het
Mxi1	C	A	19: 53,370,338	S131*	probably null	Het
Nanog	G	T	6: 122,713,340	A210S	probably benign	Het
Nrcam	C	T	12: 44,575,986	Q988*	probably null	Het
Nsg1	C	A	5: 38,159,047		probably benign	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1121	T	A	2: 87,372,088	C185*	probably null	Het
Olfr1228	T	C	2: 89,248,690		probably null	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	A	2: 89,978,153	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,314,320		probably null	Het
Olfr548-ps1	T	A	7: 102,542,380	V148E	possibly damaging	Het
Olfr58	T	G	9: 19,783,576	S148A	possibly damaging	Het
Olfr632	T	C	7: 103,937,503	V41A	probably benign	Het
Olfr920	A	T	9: 38,756,407	T240S	probably damaging	Het
Olfr980	A	T	9: 40,006,742	M69K	possibly damaging	Het
Orc3	A	T	4: 34,571,774	M665K	possibly damaging	Het
Pabpc1	A	G	15: 36,597,011	S591P	probably damaging	Het
Parp6	T	A	9: 59,624,362		probably null	Het
Pcdh1	T	C	18: 38,189,859	M974V	possibly damaging	Het
Pcdhb22	T	A	18: 37,520,660	V727E	possibly damaging	Het
Pex5l	T	C	3: 32,992,985	E272G	probably damaging	Het
Pglyrp2	G	T	17: 32,418,261	N264K	probably benign	Het
Phxr4	T	A	9: 13,431,586		probably benign	Het
Piezo2	A	G	18: 63,144,954	F293S	probably damaging	Het
Pkhd1	T	C	1: 20,537,401	D1077G	probably damaging	Het
Plekhs1	A	G	19: 56,473,268		probably null	Het
Prex1	G	T	2: 166,585,857	C788*	probably null	Het
Prrt3	A	T	6: 113,498,138	M41K	probably benign	Het
Ptgir	T	C	7: 16,908,843	V326A	probably damaging	Het
Ptprg	T	A	14: 12,220,654	D455E	probably damaging	Het
Ptpru	T	A	4: 131,799,603	Q686L	probably benign	Het
Pxdc1	G	T	13: 34,630,360	T190K	probably benign	Het
Rap1b	A	T	10: 117,818,582	C118S	probably benign	Het
Rapgef2	T	C	3: 79,083,227	M915V	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpe65	C	T	3: 159,624,681	A495V	probably benign	Het
Samd15	A	G	12: 87,200,834	T98A	possibly damaging	Het
Sdk1	T	G	5: 141,582,294	D82E	probably benign	Het
Slc26a7	T	C	4: 14,546,309	D340G	probably benign	Het
Slc6a15	T	A	10: 103,418,060	M619K	probably benign	Het
Slc7a4	C	A	16: 17,574,521	D350Y	probably damaging	Het
Slk	T	G	19: 47,619,956	N449K	probably benign	Het
Spta1	A	T	1: 174,244,042		probably null	Het
Sptbn5	A	T	2: 120,055,893		probably benign	Het
Srd5a2	A	T	17: 74,047,805	V8D	probably benign	Het
Srgap3	G	A	6: 112,727,310	A906V	probably benign	Het
Stab2	A	T	10: 86,947,147	M679K	probably benign	Het
Stk3	T	C	15: 34,999,908	I291V	probably benign	Het
Supt6	T	A	11: 78,208,134	Q1637L	possibly damaging	Het
Svil	T	C	18: 5,114,564	F2047S	probably damaging	Het
Swsap1	A	G	9: 21,955,988	E76G	probably benign	Het
Syndig1	G	T	2: 149,899,553	G20C	probably damaging	Het
Synj2bp	A	T	12: 81,502,152	N104K	probably damaging	Het
Synpo2	T	A	3: 123,114,419	D416V	probably damaging	Het
Tacc3	G	T	5: 33,672,013	C620F	probably damaging	Het
Tanc1	A	G	2: 59,699,422	E19G	probably damaging	Het
Tarsl2	C	T	7: 65,647,554	A139V	probably benign	Het
Tbc1d22a	T	A	15: 86,351,734	C365S	probably damaging	Het
Tdpoz2	T	C	3: 93,652,074	H197R	possibly damaging	Het
Tha1	A	T	11: 117,869,379	N300K	probably damaging	Het
Tm6sf1	T	A	7: 81,865,260	F70L	probably damaging	Het
Tmem132b	T	A	5: 125,783,433	S581T	probably benign	Het
Tmem206	A	T	1: 191,340,843	I154F	probably damaging	Het
Tnfsf13	G	T	11: 69,685,249	S4*	probably null	Het
Tonsl	G	A	15: 76,633,248	S757L	probably benign	Het
Trem2	G	T	17: 48,351,691	R161S	possibly damaging	Het
Trpm2	A	T	10: 77,941,173	V430E	probably damaging	Het
Ttc14	T	A	3: 33,801,369	D154E	possibly damaging	Het
Ugt2b37	T	C	5: 87,250,639	M313V	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,877,394	A107T	probably damaging	Het
Vmn2r24	A	G	6: 123,815,780	I689V	probably benign	Het
Wdr76	A	G	2: 121,542,494	T601A	probably benign	Het
Xirp1	T	C	9: 120,017,003	D938G	possibly damaging	Het
Zfp608	A	T	18: 54,897,969	D966E	probably benign	Het
Zfp957	A	G	14: 79,214,356	M1T	probably null	Het
Zkscan16	A	T	4: 58,957,809	H697L	possibly damaging	Het

Other mutations in Eif4g3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01817:Eif4g3	APN	4	138120362	missense	probably benign	0.01
IGL02171:Eif4g3	APN	4	138126589	missense	probably benign	0.03
IGL02487:Eif4g3	APN	4	138203378	missense	possibly damaging	0.92
IGL02514:Eif4g3	APN	4	138126194	missense	possibly damaging	0.87
IGL02622:Eif4g3	APN	4	138097366	splice site	probably benign
IGL02725:Eif4g3	APN	4	138170471	splice site	probably benign
IGL02735:Eif4g3	APN	4	138126211	missense	probably benign	0.40
IGL03008:Eif4g3	APN	4	138120388	missense	probably damaging	1.00
IGL03077:Eif4g3	APN	4	138125855	missense	probably damaging	1.00
N/A - 535:Eif4g3	UTSW	4	138120428	missense	probably damaging	0.98
R0013:Eif4g3	UTSW	4	138175848	missense	possibly damaging	0.88
R0193:Eif4g3	UTSW	4	138146376	splice site	probably benign
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0563:Eif4g3	UTSW	4	138175840	splice site	probably benign
R0841:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R0884:Eif4g3	UTSW	4	138151776	missense	possibly damaging	0.76
R1116:Eif4g3	UTSW	4	138091775	critical splice donor site	probably null
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1192:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R1401:Eif4g3	UTSW	4	138206084	missense	probably damaging	0.99
R1535:Eif4g3	UTSW	4	138097302	missense	probably damaging	1.00
R1571:Eif4g3	UTSW	4	138120408	missense	probably damaging	1.00
R1576:Eif4g3	UTSW	4	138096870	missense	probably damaging	0.99
R1607:Eif4g3	UTSW	4	138126563	missense	probably benign	0.00
R1618:Eif4g3	UTSW	4	138206058	missense	probably damaging	1.00
R1793:Eif4g3	UTSW	4	138171131	missense	probably damaging	1.00
R1823:Eif4g3	UTSW	4	138180491	missense	probably benign	0.37
R1857:Eif4g3	UTSW	4	138175876	missense	possibly damaging	0.67
R1907:Eif4g3	UTSW	4	138158415	missense	probably damaging	1.00
R2041:Eif4g3	UTSW	4	138105306	splice site	probably benign
R2106:Eif4g3	UTSW	4	138082919	start gained	probably benign
R2124:Eif4g3	UTSW	4	138184742	missense	probably damaging	1.00
R2301:Eif4g3	UTSW	4	138172659	missense	probably damaging	1.00
R2519:Eif4g3	UTSW	4	138097318	missense	probably benign	0.37
R3033:Eif4g3	UTSW	4	138103410	missense	probably damaging	1.00
R3870:Eif4g3	UTSW	4	138096900	missense	probably damaging	0.98
R4542:Eif4g3	UTSW	4	138203417	missense	probably damaging	0.99
R4582:Eif4g3	UTSW	4	138171245	missense	probably damaging	1.00
R4607:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4608:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4658:Eif4g3	UTSW	4	138206132	missense	probably damaging	1.00
R4736:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4739:Eif4g3	UTSW	4	138183199	missense	possibly damaging	0.79
R4739:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4740:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4760:Eif4g3	UTSW	4	138084318	missense	possibly damaging	0.46
R4826:Eif4g3	UTSW	4	138177945	missense	possibly damaging	0.95
R4941:Eif4g3	UTSW	4	138170565	missense	probably damaging	1.00
R5040:Eif4g3	UTSW	4	138096889	missense	probably damaging	0.99
R5070:Eif4g3	UTSW	4	138146299	missense	probably benign	0.00
R5155:Eif4g3	UTSW	4	138126743	missense	probably benign	0.36
R5226:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5229:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5303:Eif4g3	UTSW	4	138126562	missense	probably benign	0.04
R5369:Eif4g3	UTSW	4	138183334	missense	possibly damaging	0.87
R5394:Eif4g3	UTSW	4	138103398	splice site	probably null
R5665:Eif4g3	UTSW	4	138126589	missense	probably benign	0.03
R5678:Eif4g3	UTSW	4	138151742	missense	probably damaging	0.99
R5695:Eif4g3	UTSW	4	138163433	splice site	probably null
R5704:Eif4g3	UTSW	4	138190692	missense	probably damaging	1.00
R5924:Eif4g3	UTSW	4	138201926	missense	probably damaging	1.00
R6214:Eif4g3	UTSW	4	138058003	missense	probably damaging	0.99
R6278:Eif4g3	UTSW	4	138188083	missense	possibly damaging	0.82
R6519:Eif4g3	UTSW	4	137994008	missense	probably benign
R6659:Eif4g3	UTSW	4	138177932	missense	probably damaging	1.00
R6720:Eif4g3	UTSW	4	138175832	splice site	probably null
R6812:Eif4g3	UTSW	4	138103376	missense	probably damaging	1.00
R6922:Eif4g3	UTSW	4	138097335	missense	probably damaging	1.00
R7175:Eif4g3	UTSW	4	138126215	missense	probably damaging	1.00
R7176:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R7598:Eif4g3	UTSW	4	138194124	missense	probably benign	0.02
R7618:Eif4g3	UTSW	4	138171118	missense	probably damaging	1.00
R7805:Eif4g3	UTSW	4	138146354	missense	probably benign	0.00
R7935:Eif4g3	UTSW	4	138096771	missense	probably damaging	1.00
R7983:Eif4g3	UTSW	4	138151593	missense	probably benign	0.00
R8261:Eif4g3	UTSW	4	138171118	missense	possibly damaging	0.46
R8371:Eif4g3	UTSW	4	138096845	missense	probably damaging	1.00
R8499:Eif4g3	UTSW	4	138165928	missense	probably damaging	1.00
R8670:Eif4g3	UTSW	4	138158512	critical splice donor site	probably null
R8672:Eif4g3	UTSW	4	138126512	missense	possibly damaging	0.75
R8744:Eif4g3	UTSW	4	137994061	small deletion	probably benign
R8767:Eif4g3	UTSW	4	138203468	missense	probably damaging	0.99
R8771:Eif4g3	UTSW	4	138180537	nonsense	probably null
R8989:Eif4g3	UTSW	4	138184748	missense	probably damaging	1.00
R9292:Eif4g3	UTSW	4	138194071	missense	possibly damaging	0.82
R9294:Eif4g3	UTSW	4	138190657	missense	probably damaging	0.98
R9607:Eif4g3	UTSW	4	138165734	missense	probably benign	0.28
R9617:Eif4g3	UTSW	4	138096879	missense	probably damaging	0.99
RF008:Eif4g3	UTSW	4	138175924	missense	probably damaging	0.98
X0067:Eif4g3	UTSW	4	138163619	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCCCATTGAACTGATATGTGCTCAG -3'
(R):5'- ATAGCATCCAGGTCCCTCAG -3'

Sequencing Primer
(F):5'- GTGCTCAGATATCTCAGATACTAGGC -3'
(R):5'- TGATTCCTAGTCATCACTGTCG -3'

Posted On

2016-03-01