Incidental Mutation 'R4825:Disc1'
ID 371410
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Name disrupted in schizophrenia 1
Synonyms
MMRRC Submission 042441-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R4825 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 125780934-125988597 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125862041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 471 (M471K)
Ref Sequence ENSEMBL: ENSMUSP00000112929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953]
AlphaFold Q811T9
Predicted Effect probably benign
Transcript: ENSMUST00000074562
AA Change: M473K

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: M473K

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075730
AA Change: M473K

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: M473K

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098311
AA Change: M473K

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: M473K

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115885
AA Change: M473K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: M473K

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117658
AA Change: M473K

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: M473K

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118942
AA Change: M473K

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: M473K

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121953
AA Change: M471K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: M471K

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,682,498 (GRCm39) L229F probably benign Het
A930002H24Rik A C 17: 64,170,603 (GRCm39) S62A unknown Het
Abca12 T A 1: 71,341,844 (GRCm39) Q1039L possibly damaging Het
Adgrg5 T A 8: 95,668,362 (GRCm39) F476I possibly damaging Het
Alms1 A G 6: 85,655,227 (GRCm39) K2789E probably damaging Het
Arrdc2 G A 8: 71,291,921 (GRCm39) probably null Het
Atp2b1 T A 10: 98,845,426 (GRCm39) I743K probably damaging Het
Atp6v1c2 C T 12: 17,339,061 (GRCm39) G230D probably benign Het
AU040320 G A 4: 126,685,586 (GRCm39) C54Y probably damaging Het
BC024139 C T 15: 76,004,517 (GRCm39) V680I possibly damaging Het
Bckdhb A G 9: 83,870,958 (GRCm39) D156G probably damaging Het
Bltp3a G A 17: 28,096,368 (GRCm39) A107T probably damaging Het
Canx T A 11: 50,199,636 (GRCm39) D143V probably benign Het
Ccdc180 T A 4: 45,912,794 (GRCm39) V591E possibly damaging Het
Ccno T C 13: 113,124,633 (GRCm39) S68P probably benign Het
Cdc45 C T 16: 18,603,613 (GRCm39) E527K probably damaging Het
Cep290 T A 10: 100,324,210 (GRCm39) D14E probably damaging Het
Cgnl1 A G 9: 71,537,806 (GRCm39) V1238A probably benign Het
Ciz1 C T 2: 32,261,753 (GRCm39) A455V probably damaging Het
Coro2b T A 9: 62,361,905 (GRCm39) Y86F probably benign Het
Csf2ra C T 19: 61,214,990 (GRCm39) R158Q probably benign Het
Cubn A T 2: 13,330,036 (GRCm39) I2615N probably damaging Het
Dhx8 C T 11: 101,628,996 (GRCm39) R129* probably null Het
Dmxl2 G T 9: 54,311,325 (GRCm39) L1799I probably benign Het
Dnah2 A G 11: 69,314,031 (GRCm39) S4108P probably damaging Het
Ecpas G A 4: 58,850,911 (GRCm39) L421F probably damaging Het
Ehmt2 C G 17: 35,125,940 (GRCm39) P211R probably benign Het
Eif4g3 A G 4: 137,921,392 (GRCm39) D1557G probably benign Het
Epha5 T C 5: 84,381,699 (GRCm39) D384G probably damaging Het
Etl4 A G 2: 20,811,738 (GRCm39) I1274V probably damaging Het
Fhip1a G A 3: 85,580,739 (GRCm39) P489S possibly damaging Het
Fip1l1 G A 5: 74,748,866 (GRCm39) probably null Het
Fubp1 T C 3: 151,923,527 (GRCm39) probably null Het
Glul T C 1: 153,778,790 (GRCm39) V33A probably benign Het
Gm4846 A G 1: 166,319,237 (GRCm39) F167S probably damaging Het
Heatr6 T A 11: 83,649,148 (GRCm39) L168M probably damaging Het
Hif1a T A 12: 73,979,175 (GRCm39) I233N probably damaging Het
Hivep2 T A 10: 14,007,063 (GRCm39) H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,292,410 (GRCm39) I9M probably benign Het
Izumo1 T A 7: 45,274,411 (GRCm39) C62* probably null Het
Jakmip3 G A 7: 138,628,495 (GRCm39) E424K probably damaging Het
Klhl2 A G 8: 65,205,847 (GRCm39) V358A probably damaging Het
Klk10 C G 7: 43,433,022 (GRCm39) D139E probably damaging Het
Klk14 T C 7: 43,341,500 (GRCm39) C51R probably damaging Het
Klk1b5 T G 7: 43,494,814 (GRCm39) I99S probably damaging Het
L3hypdh T C 12: 72,124,167 (GRCm39) T258A probably benign Het
Lrp5 A G 19: 3,664,292 (GRCm39) Y812H probably damaging Het
Lrrc40 T A 3: 157,766,967 (GRCm39) L474* probably null Het
Mkks A T 2: 136,722,575 (GRCm39) M194K probably benign Het
Mmp20 A G 9: 7,654,121 (GRCm39) D347G probably damaging Het
Mmp27 A G 9: 7,581,195 (GRCm39) E460G probably damaging Het
Mms22l T C 4: 24,536,226 (GRCm39) F605S probably damaging Het
Mpzl3 A G 9: 44,979,627 (GRCm39) S193G probably benign Het
Muc4 A T 16: 32,570,565 (GRCm39) T542S probably benign Het
Muc5b T C 7: 141,422,202 (GRCm39) L4446P possibly damaging Het
Mxi1 C A 19: 53,358,769 (GRCm39) S131* probably null Het
Nanog G T 6: 122,690,299 (GRCm39) A210S probably benign Het
Nrcam C T 12: 44,622,769 (GRCm39) Q988* probably null Het
Nsg1 C A 5: 38,316,391 (GRCm39) probably benign Het
Ogfod3 G A 11: 121,086,027 (GRCm39) A189V probably benign Het
Or10g9b A T 9: 39,918,038 (GRCm39) M69K possibly damaging Het
Or12e9 T A 2: 87,202,432 (GRCm39) C185* probably null Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c122 T C 2: 89,079,034 (GRCm39) probably null Het
Or4c35 G A 2: 89,808,497 (GRCm39) C125Y probably damaging Het
Or51ai2 T C 7: 103,586,710 (GRCm39) V41A probably benign Het
Or52b4i T A 7: 102,191,587 (GRCm39) V148E possibly damaging Het
Or5b111 A T 19: 13,291,684 (GRCm39) probably null Het
Or7e165 T G 9: 19,694,872 (GRCm39) S148A possibly damaging Het
Or8b53 A T 9: 38,667,703 (GRCm39) T240S probably damaging Het
Orc3 A T 4: 34,571,774 (GRCm39) M665K possibly damaging Het
Pabpc1 A G 15: 36,597,255 (GRCm39) S591P probably damaging Het
Pacc1 A T 1: 191,073,040 (GRCm39) I154F probably damaging Het
Parp6 T A 9: 59,531,645 (GRCm39) probably null Het
Pcdh1 T C 18: 38,322,912 (GRCm39) M974V possibly damaging Het
Pcdhb22 T A 18: 37,653,713 (GRCm39) V727E possibly damaging Het
Pex5l T C 3: 33,047,134 (GRCm39) E272G probably damaging Het
Pglyrp2 G T 17: 32,637,235 (GRCm39) N264K probably benign Het
Phxr4 T A 9: 13,342,882 (GRCm39) probably benign Het
Piezo2 A G 18: 63,278,025 (GRCm39) F293S probably damaging Het
Pkhd1 T C 1: 20,607,625 (GRCm39) D1077G probably damaging Het
Plekhs1 A G 19: 56,461,700 (GRCm39) probably null Het
Prex1 G T 2: 166,427,777 (GRCm39) C788* probably null Het
Prrt3 A T 6: 113,475,099 (GRCm39) M41K probably benign Het
Ptgir T C 7: 16,642,768 (GRCm39) V326A probably damaging Het
Ptprg T A 14: 12,220,654 (GRCm38) D455E probably damaging Het
Ptpru T A 4: 131,526,914 (GRCm39) Q686L probably benign Het
Pxdc1 G T 13: 34,814,343 (GRCm39) T190K probably benign Het
Rap1b A T 10: 117,654,487 (GRCm39) C118S probably benign Het
Rapgef2 T C 3: 78,990,534 (GRCm39) M915V probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpe65 C T 3: 159,330,318 (GRCm39) A495V probably benign Het
Samd15 A G 12: 87,247,608 (GRCm39) T98A possibly damaging Het
Sdk1 T G 5: 141,568,049 (GRCm39) D82E probably benign Het
Slc26a7 T C 4: 14,546,309 (GRCm39) D340G probably benign Het
Slc6a15 T A 10: 103,253,921 (GRCm39) M619K probably benign Het
Slc7a4 C A 16: 17,392,385 (GRCm39) D350Y probably damaging Het
Slk T G 19: 47,608,395 (GRCm39) N449K probably benign Het
Spta1 A T 1: 174,071,608 (GRCm39) probably null Het
Sptbn5 A T 2: 119,886,374 (GRCm39) probably benign Het
Srd5a2 A T 17: 74,354,800 (GRCm39) V8D probably benign Het
Srgap3 G A 6: 112,704,271 (GRCm39) A906V probably benign Het
Stab2 A T 10: 86,783,011 (GRCm39) M679K probably benign Het
Stk3 T C 15: 35,000,054 (GRCm39) I291V probably benign Het
Supt6 T A 11: 78,098,960 (GRCm39) Q1637L possibly damaging Het
Svil T C 18: 5,114,564 (GRCm39) F2047S probably damaging Het
Swsap1 A G 9: 21,867,284 (GRCm39) E76G probably benign Het
Syndig1 G T 2: 149,741,473 (GRCm39) G20C probably damaging Het
Synj2bp A T 12: 81,548,926 (GRCm39) N104K probably damaging Het
Synpo2 T A 3: 122,908,068 (GRCm39) D416V probably damaging Het
Tacc3 G T 5: 33,829,357 (GRCm39) C620F probably damaging Het
Tanc1 A G 2: 59,529,766 (GRCm39) E19G probably damaging Het
Tars3 C T 7: 65,297,302 (GRCm39) A139V probably benign Het
Tbc1d22a T A 15: 86,235,935 (GRCm39) C365S probably damaging Het
Tdpoz2 T C 3: 93,559,381 (GRCm39) H197R possibly damaging Het
Tha1 A T 11: 117,760,205 (GRCm39) N300K probably damaging Het
Tm6sf1 T A 7: 81,515,008 (GRCm39) F70L probably damaging Het
Tmem132b T A 5: 125,860,497 (GRCm39) S581T probably benign Het
Tnfsf13 G T 11: 69,576,075 (GRCm39) S4* probably null Het
Tonsl G A 15: 76,517,448 (GRCm39) S757L probably benign Het
Trem2 G T 17: 48,658,719 (GRCm39) R161S possibly damaging Het
Trpm2 A T 10: 77,777,007 (GRCm39) V430E probably damaging Het
Ttc14 T A 3: 33,855,518 (GRCm39) D154E possibly damaging Het
Ugt2b37 T C 5: 87,398,498 (GRCm39) M313V possibly damaging Het
Vmn2r24 A G 6: 123,792,739 (GRCm39) I689V probably benign Het
Wdr76 A G 2: 121,372,975 (GRCm39) T601A probably benign Het
Xirp1 T C 9: 119,846,069 (GRCm39) D938G possibly damaging Het
Zfp608 A T 18: 55,031,041 (GRCm39) D966E probably benign Het
Zfp957 A G 14: 79,451,796 (GRCm39) M1T probably null Het
Zkscan16 A T 4: 58,957,809 (GRCm39) H697L possibly damaging Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125,815,014 (GRCm39) missense probably benign 0.27
IGL01319:Disc1 APN 8 125,814,630 (GRCm39) missense probably damaging 0.99
IGL02001:Disc1 APN 8 125,977,781 (GRCm39) missense probably damaging 0.97
IGL02403:Disc1 APN 8 125,862,258 (GRCm39) splice site probably benign
IGL02445:Disc1 APN 8 125,875,142 (GRCm39) splice site probably benign
R0334:Disc1 UTSW 8 125,987,836 (GRCm39) splice site probably null
R0992:Disc1 UTSW 8 125,814,781 (GRCm39) missense probably damaging 1.00
R1654:Disc1 UTSW 8 125,875,204 (GRCm39) missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125,851,349 (GRCm39) missense probably benign 0.05
R3154:Disc1 UTSW 8 125,862,043 (GRCm39) missense probably damaging 1.00
R3947:Disc1 UTSW 8 125,814,874 (GRCm39) missense probably damaging 1.00
R3948:Disc1 UTSW 8 125,814,874 (GRCm39) missense probably damaging 1.00
R3949:Disc1 UTSW 8 125,814,874 (GRCm39) missense probably damaging 1.00
R4051:Disc1 UTSW 8 125,875,164 (GRCm39) missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125,875,198 (GRCm39) missense probably damaging 1.00
R4691:Disc1 UTSW 8 125,875,186 (GRCm39) missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125,851,277 (GRCm39) missense probably damaging 1.00
R4969:Disc1 UTSW 8 125,851,289 (GRCm39) nonsense probably null
R5087:Disc1 UTSW 8 125,858,899 (GRCm39) missense probably benign
R5383:Disc1 UTSW 8 125,862,196 (GRCm39) missense probably damaging 1.00
R5827:Disc1 UTSW 8 125,862,104 (GRCm39) missense probably damaging 1.00
R5828:Disc1 UTSW 8 125,977,763 (GRCm39) missense probably damaging 0.99
R6431:Disc1 UTSW 8 125,862,128 (GRCm39) missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125,944,844 (GRCm39) missense probably benign 0.00
R6794:Disc1 UTSW 8 125,814,514 (GRCm39) missense probably benign 0.37
R7058:Disc1 UTSW 8 125,977,724 (GRCm39) missense probably damaging 1.00
R7350:Disc1 UTSW 8 125,891,841 (GRCm39) missense probably damaging 1.00
R7365:Disc1 UTSW 8 125,881,780 (GRCm39) missense probably damaging 1.00
R7732:Disc1 UTSW 8 125,977,714 (GRCm39) nonsense probably null
R7757:Disc1 UTSW 8 125,814,243 (GRCm39) missense probably benign 0.03
R8113:Disc1 UTSW 8 125,815,014 (GRCm39) missense probably benign 0.27
R8179:Disc1 UTSW 8 125,814,316 (GRCm39) missense probably benign 0.05
R8400:Disc1 UTSW 8 125,959,732 (GRCm39) missense probably benign 0.02
R8459:Disc1 UTSW 8 125,891,894 (GRCm39) missense possibly damaging 0.91
R8492:Disc1 UTSW 8 125,817,177 (GRCm39) missense probably damaging 1.00
R8762:Disc1 UTSW 8 125,881,796 (GRCm39) missense probably damaging 1.00
R8857:Disc1 UTSW 8 125,891,870 (GRCm39) missense probably damaging 1.00
R8858:Disc1 UTSW 8 125,977,781 (GRCm39) missense probably damaging 0.97
R8936:Disc1 UTSW 8 125,814,754 (GRCm39) missense probably damaging 0.97
R9365:Disc1 UTSW 8 125,851,285 (GRCm39) missense probably benign 0.00
R9599:Disc1 UTSW 8 125,814,261 (GRCm39) missense possibly damaging 0.91
R9728:Disc1 UTSW 8 125,959,795 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAAACTTCTGGAATCTGCC -3'
(R):5'- GAAAGTCACCAGTACCTCCTG -3'

Sequencing Primer
(F):5'- AATCTGCCTGCCTCGGAAG -3'
(R):5'- ACCTGGAAGGGAGCCTG -3'
Posted On 2016-03-01