Incidental Mutation 'R0422:Slc7a15'
Institutional Source Beutler Lab
Gene Symbol Slc7a15
Ensembl Gene ENSMUSG00000020600
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 15
Synonyms9030221C07Rik, 2010001P20Rik, Arpat
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0422 (G1)
Quality Score216
Status Not validated
Chromosomal Location8528483-8599066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8534400 bp
Amino Acid Change Threonine to Alanine at position 117 (T117A)
Ref Sequence ENSEMBL: ENSMUSP00000129806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036938] [ENSMUST00000095863] [ENSMUST00000165657]
Predicted Effect probably benign
Transcript: ENSMUST00000036938
AA Change: T117A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047873
Gene: ENSMUSG00000020600
AA Change: T117A

Pfam:AA_permease_2 1 197 2.6e-20 PFAM
Pfam:AA_permease 1 221 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095863
AA Change: T377A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093548
Gene: ENSMUSG00000020600
AA Change: T377A

Pfam:AA_permease_2 31 453 2.6e-57 PFAM
Pfam:AA_permease 35 480 2.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129465
Predicted Effect probably benign
Transcript: ENSMUST00000165657
AA Change: T117A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129806
Gene: ENSMUSG00000020600
AA Change: T117A

Pfam:AA_permease_2 1 197 2.6e-20 PFAM
Pfam:AA_permease 1 221 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219595
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Slc7a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Slc7a15 APN 12 8539121 missense probably damaging 1.00
IGL00507:Slc7a15 APN 12 8535474 missense probably damaging 1.00
IGL01839:Slc7a15 APN 12 8539365 missense probably damaging 1.00
IGL02006:Slc7a15 APN 12 8535508 critical splice acceptor site probably null
IGL02201:Slc7a15 APN 12 8539023 missense possibly damaging 0.93
R0794:Slc7a15 UTSW 12 8539278 missense probably benign 0.19
R1194:Slc7a15 UTSW 12 8535772 missense probably damaging 1.00
R1420:Slc7a15 UTSW 12 8534442 missense probably benign 0.01
R2696:Slc7a15 UTSW 12 8529345 makesense probably null
R4809:Slc7a15 UTSW 12 8539002 missense probably benign 0.10
R5236:Slc7a15 UTSW 12 8539005 missense probably benign 0.38
R5579:Slc7a15 UTSW 12 8539344 missense probably benign 0.00
R6453:Slc7a15 UTSW 12 8534490 missense possibly damaging 0.77
R7136:Slc7a15 UTSW 12 8538895 missense probably damaging 0.98
R8005:Slc7a15 UTSW 12 8539395 missense probably damaging 0.97
X0027:Slc7a15 UTSW 12 8539350 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcacataggcattccagaagac -3'
Posted On2013-05-09