Incidental Mutation 'R4825:Trpm2'
ID 371426
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission 042441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R4825 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77777007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 430 (V430E)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: V430E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: V430E

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,682,498 (GRCm39) L229F probably benign Het
A930002H24Rik A C 17: 64,170,603 (GRCm39) S62A unknown Het
Abca12 T A 1: 71,341,844 (GRCm39) Q1039L possibly damaging Het
Adgrg5 T A 8: 95,668,362 (GRCm39) F476I possibly damaging Het
Alms1 A G 6: 85,655,227 (GRCm39) K2789E probably damaging Het
Arrdc2 G A 8: 71,291,921 (GRCm39) probably null Het
Atp2b1 T A 10: 98,845,426 (GRCm39) I743K probably damaging Het
Atp6v1c2 C T 12: 17,339,061 (GRCm39) G230D probably benign Het
AU040320 G A 4: 126,685,586 (GRCm39) C54Y probably damaging Het
BC024139 C T 15: 76,004,517 (GRCm39) V680I possibly damaging Het
Bckdhb A G 9: 83,870,958 (GRCm39) D156G probably damaging Het
Bltp3a G A 17: 28,096,368 (GRCm39) A107T probably damaging Het
Canx T A 11: 50,199,636 (GRCm39) D143V probably benign Het
Ccdc180 T A 4: 45,912,794 (GRCm39) V591E possibly damaging Het
Ccno T C 13: 113,124,633 (GRCm39) S68P probably benign Het
Cdc45 C T 16: 18,603,613 (GRCm39) E527K probably damaging Het
Cep290 T A 10: 100,324,210 (GRCm39) D14E probably damaging Het
Cgnl1 A G 9: 71,537,806 (GRCm39) V1238A probably benign Het
Ciz1 C T 2: 32,261,753 (GRCm39) A455V probably damaging Het
Coro2b T A 9: 62,361,905 (GRCm39) Y86F probably benign Het
Csf2ra C T 19: 61,214,990 (GRCm39) R158Q probably benign Het
Cubn A T 2: 13,330,036 (GRCm39) I2615N probably damaging Het
Dhx8 C T 11: 101,628,996 (GRCm39) R129* probably null Het
Disc1 T A 8: 125,862,041 (GRCm39) M471K possibly damaging Het
Dmxl2 G T 9: 54,311,325 (GRCm39) L1799I probably benign Het
Dnah2 A G 11: 69,314,031 (GRCm39) S4108P probably damaging Het
Ecpas G A 4: 58,850,911 (GRCm39) L421F probably damaging Het
Ehmt2 C G 17: 35,125,940 (GRCm39) P211R probably benign Het
Eif4g3 A G 4: 137,921,392 (GRCm39) D1557G probably benign Het
Epha5 T C 5: 84,381,699 (GRCm39) D384G probably damaging Het
Etl4 A G 2: 20,811,738 (GRCm39) I1274V probably damaging Het
Fhip1a G A 3: 85,580,739 (GRCm39) P489S possibly damaging Het
Fip1l1 G A 5: 74,748,866 (GRCm39) probably null Het
Fubp1 T C 3: 151,923,527 (GRCm39) probably null Het
Glul T C 1: 153,778,790 (GRCm39) V33A probably benign Het
Gm4846 A G 1: 166,319,237 (GRCm39) F167S probably damaging Het
Heatr6 T A 11: 83,649,148 (GRCm39) L168M probably damaging Het
Hif1a T A 12: 73,979,175 (GRCm39) I233N probably damaging Het
Hivep2 T A 10: 14,007,063 (GRCm39) H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,292,410 (GRCm39) I9M probably benign Het
Izumo1 T A 7: 45,274,411 (GRCm39) C62* probably null Het
Jakmip3 G A 7: 138,628,495 (GRCm39) E424K probably damaging Het
Klhl2 A G 8: 65,205,847 (GRCm39) V358A probably damaging Het
Klk10 C G 7: 43,433,022 (GRCm39) D139E probably damaging Het
Klk14 T C 7: 43,341,500 (GRCm39) C51R probably damaging Het
Klk1b5 T G 7: 43,494,814 (GRCm39) I99S probably damaging Het
L3hypdh T C 12: 72,124,167 (GRCm39) T258A probably benign Het
Lrp5 A G 19: 3,664,292 (GRCm39) Y812H probably damaging Het
Lrrc40 T A 3: 157,766,967 (GRCm39) L474* probably null Het
Mkks A T 2: 136,722,575 (GRCm39) M194K probably benign Het
Mmp20 A G 9: 7,654,121 (GRCm39) D347G probably damaging Het
Mmp27 A G 9: 7,581,195 (GRCm39) E460G probably damaging Het
Mms22l T C 4: 24,536,226 (GRCm39) F605S probably damaging Het
Mpzl3 A G 9: 44,979,627 (GRCm39) S193G probably benign Het
Muc4 A T 16: 32,570,565 (GRCm39) T542S probably benign Het
Muc5b T C 7: 141,422,202 (GRCm39) L4446P possibly damaging Het
Mxi1 C A 19: 53,358,769 (GRCm39) S131* probably null Het
Nanog G T 6: 122,690,299 (GRCm39) A210S probably benign Het
Nrcam C T 12: 44,622,769 (GRCm39) Q988* probably null Het
Nsg1 C A 5: 38,316,391 (GRCm39) probably benign Het
Ogfod3 G A 11: 121,086,027 (GRCm39) A189V probably benign Het
Or10g9b A T 9: 39,918,038 (GRCm39) M69K possibly damaging Het
Or12e9 T A 2: 87,202,432 (GRCm39) C185* probably null Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c122 T C 2: 89,079,034 (GRCm39) probably null Het
Or4c35 G A 2: 89,808,497 (GRCm39) C125Y probably damaging Het
Or51ai2 T C 7: 103,586,710 (GRCm39) V41A probably benign Het
Or52b4i T A 7: 102,191,587 (GRCm39) V148E possibly damaging Het
Or5b111 A T 19: 13,291,684 (GRCm39) probably null Het
Or7e165 T G 9: 19,694,872 (GRCm39) S148A possibly damaging Het
Or8b53 A T 9: 38,667,703 (GRCm39) T240S probably damaging Het
Orc3 A T 4: 34,571,774 (GRCm39) M665K possibly damaging Het
Pabpc1 A G 15: 36,597,255 (GRCm39) S591P probably damaging Het
Pacc1 A T 1: 191,073,040 (GRCm39) I154F probably damaging Het
Parp6 T A 9: 59,531,645 (GRCm39) probably null Het
Pcdh1 T C 18: 38,322,912 (GRCm39) M974V possibly damaging Het
Pcdhb22 T A 18: 37,653,713 (GRCm39) V727E possibly damaging Het
Pex5l T C 3: 33,047,134 (GRCm39) E272G probably damaging Het
Pglyrp2 G T 17: 32,637,235 (GRCm39) N264K probably benign Het
Phxr4 T A 9: 13,342,882 (GRCm39) probably benign Het
Piezo2 A G 18: 63,278,025 (GRCm39) F293S probably damaging Het
Pkhd1 T C 1: 20,607,625 (GRCm39) D1077G probably damaging Het
Plekhs1 A G 19: 56,461,700 (GRCm39) probably null Het
Prex1 G T 2: 166,427,777 (GRCm39) C788* probably null Het
Prrt3 A T 6: 113,475,099 (GRCm39) M41K probably benign Het
Ptgir T C 7: 16,642,768 (GRCm39) V326A probably damaging Het
Ptprg T A 14: 12,220,654 (GRCm38) D455E probably damaging Het
Ptpru T A 4: 131,526,914 (GRCm39) Q686L probably benign Het
Pxdc1 G T 13: 34,814,343 (GRCm39) T190K probably benign Het
Rap1b A T 10: 117,654,487 (GRCm39) C118S probably benign Het
Rapgef2 T C 3: 78,990,534 (GRCm39) M915V probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpe65 C T 3: 159,330,318 (GRCm39) A495V probably benign Het
Samd15 A G 12: 87,247,608 (GRCm39) T98A possibly damaging Het
Sdk1 T G 5: 141,568,049 (GRCm39) D82E probably benign Het
Slc26a7 T C 4: 14,546,309 (GRCm39) D340G probably benign Het
Slc6a15 T A 10: 103,253,921 (GRCm39) M619K probably benign Het
Slc7a4 C A 16: 17,392,385 (GRCm39) D350Y probably damaging Het
Slk T G 19: 47,608,395 (GRCm39) N449K probably benign Het
Spta1 A T 1: 174,071,608 (GRCm39) probably null Het
Sptbn5 A T 2: 119,886,374 (GRCm39) probably benign Het
Srd5a2 A T 17: 74,354,800 (GRCm39) V8D probably benign Het
Srgap3 G A 6: 112,704,271 (GRCm39) A906V probably benign Het
Stab2 A T 10: 86,783,011 (GRCm39) M679K probably benign Het
Stk3 T C 15: 35,000,054 (GRCm39) I291V probably benign Het
Supt6 T A 11: 78,098,960 (GRCm39) Q1637L possibly damaging Het
Svil T C 18: 5,114,564 (GRCm39) F2047S probably damaging Het
Swsap1 A G 9: 21,867,284 (GRCm39) E76G probably benign Het
Syndig1 G T 2: 149,741,473 (GRCm39) G20C probably damaging Het
Synj2bp A T 12: 81,548,926 (GRCm39) N104K probably damaging Het
Synpo2 T A 3: 122,908,068 (GRCm39) D416V probably damaging Het
Tacc3 G T 5: 33,829,357 (GRCm39) C620F probably damaging Het
Tanc1 A G 2: 59,529,766 (GRCm39) E19G probably damaging Het
Tars3 C T 7: 65,297,302 (GRCm39) A139V probably benign Het
Tbc1d22a T A 15: 86,235,935 (GRCm39) C365S probably damaging Het
Tdpoz2 T C 3: 93,559,381 (GRCm39) H197R possibly damaging Het
Tha1 A T 11: 117,760,205 (GRCm39) N300K probably damaging Het
Tm6sf1 T A 7: 81,515,008 (GRCm39) F70L probably damaging Het
Tmem132b T A 5: 125,860,497 (GRCm39) S581T probably benign Het
Tnfsf13 G T 11: 69,576,075 (GRCm39) S4* probably null Het
Tonsl G A 15: 76,517,448 (GRCm39) S757L probably benign Het
Trem2 G T 17: 48,658,719 (GRCm39) R161S possibly damaging Het
Ttc14 T A 3: 33,855,518 (GRCm39) D154E possibly damaging Het
Ugt2b37 T C 5: 87,398,498 (GRCm39) M313V possibly damaging Het
Vmn2r24 A G 6: 123,792,739 (GRCm39) I689V probably benign Het
Wdr76 A G 2: 121,372,975 (GRCm39) T601A probably benign Het
Xirp1 T C 9: 119,846,069 (GRCm39) D938G possibly damaging Het
Zfp608 A T 18: 55,031,041 (GRCm39) D966E probably benign Het
Zfp957 A G 14: 79,451,796 (GRCm39) M1T probably null Het
Zkscan16 A T 4: 58,957,809 (GRCm39) H697L possibly damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,776,992 (GRCm39) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,768,061 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7527:Trpm2 UTSW 10 77,801,894 (GRCm39) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,778,776 (GRCm39) nonsense probably null
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTTACACTGACTCAAACGTTTT -3'
(R):5'- AGAGTATCACTCCTTGTTGGGGC -3'

Sequencing Primer
(F):5'- GGGATAACAGTCATCTCACGTTGC -3'
(R):5'- GGGGCCTTGATTCTCTTTGACC -3'
Posted On 2016-03-01