Incidental Mutation 'R4825:Stab2'
ID 371427
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms STAB-2, FEEL-2
MMRRC Submission 042441-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4825 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86841198-87008025 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86947147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 679 (M679K)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: M679K

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: M679K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,791,672 L229F probably benign Het
A930002H24Rik A C 17: 63,863,608 S62A unknown Het
Abca12 T A 1: 71,302,685 Q1039L possibly damaging Het
Adgrg5 T A 8: 94,941,734 F476I possibly damaging Het
AI314180 G A 4: 58,850,911 L421F probably damaging Het
Alms1 A G 6: 85,678,245 K2789E probably damaging Het
Arrdc2 G A 8: 70,839,277 probably null Het
Atp2b1 T A 10: 99,009,564 I743K probably damaging Het
Atp6v1c2 C T 12: 17,289,060 G230D probably benign Het
AU040320 G A 4: 126,791,793 C54Y probably damaging Het
BC024139 C T 15: 76,120,317 V680I possibly damaging Het
Bckdhb A G 9: 83,988,905 D156G probably damaging Het
Canx T A 11: 50,308,809 D143V probably benign Het
Ccdc180 T A 4: 45,912,794 V591E possibly damaging Het
Ccno T C 13: 112,988,099 S68P probably benign Het
Cdc45 C T 16: 18,784,863 E527K probably damaging Het
Cep290 T A 10: 100,488,348 D14E probably damaging Het
Cgnl1 A G 9: 71,630,524 V1238A probably benign Het
Ciz1 C T 2: 32,371,741 A455V probably damaging Het
Coro2b T A 9: 62,454,623 Y86F probably benign Het
Csf2ra C T 19: 61,226,552 R158Q probably benign Het
Cubn A T 2: 13,325,225 I2615N probably damaging Het
Dhx8 C T 11: 101,738,170 R129* probably null Het
Disc1 T A 8: 125,135,302 M471K possibly damaging Het
Dmxl2 G T 9: 54,404,041 L1799I probably benign Het
Dnah2 A G 11: 69,423,205 S4108P probably damaging Het
Ehmt2 C G 17: 34,906,964 P211R probably benign Het
Eif4g3 A G 4: 138,194,081 D1557G probably benign Het
Epha5 T C 5: 84,233,840 D384G probably damaging Het
Etl4 A G 2: 20,806,927 I1274V probably damaging Het
Fam160a1 G A 3: 85,673,432 P489S possibly damaging Het
Fip1l1 G A 5: 74,588,205 probably null Het
Fubp1 T C 3: 152,217,890 probably null Het
Glul T C 1: 153,903,044 V33A probably benign Het
Gm4846 A G 1: 166,491,668 F167S probably damaging Het
Heatr6 T A 11: 83,758,322 L168M probably damaging Het
Hif1a T A 12: 73,932,401 I233N probably damaging Het
Hivep2 T A 10: 14,131,319 H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,315,426 I9M probably benign Het
Izumo1 T A 7: 45,624,987 C62* probably null Het
Jakmip3 G A 7: 139,026,766 E424K probably damaging Het
Klhl2 A G 8: 64,752,813 V358A probably damaging Het
Klk10 C G 7: 43,783,598 D139E probably damaging Het
Klk14 T C 7: 43,692,076 C51R probably damaging Het
Klk5 T G 7: 43,845,390 I99S probably damaging Het
L3hypdh T C 12: 72,077,393 T258A probably benign Het
Lrp5 A G 19: 3,614,292 Y812H probably damaging Het
Lrrc40 T A 3: 158,061,330 L474* probably null Het
Mkks A T 2: 136,880,655 M194K probably benign Het
Mmp20 A G 9: 7,654,120 D347G probably damaging Het
Mmp27 A G 9: 7,581,194 E460G probably damaging Het
Mms22l T C 4: 24,536,226 F605S probably damaging Het
Mpzl3 A G 9: 45,068,329 S193G probably benign Het
Muc4 A T 16: 32,751,747 T542S probably benign Het
Muc5b T C 7: 141,868,465 L4446P possibly damaging Het
Mxi1 C A 19: 53,370,338 S131* probably null Het
Nanog G T 6: 122,713,340 A210S probably benign Het
Nrcam C T 12: 44,575,986 Q988* probably null Het
Nsg1 C A 5: 38,159,047 probably benign Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1121 T A 2: 87,372,088 C185* probably null Het
Olfr1228 T C 2: 89,248,690 probably null Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G A 2: 89,978,153 C125Y probably damaging Het
Olfr1465 A T 19: 13,314,320 probably null Het
Olfr548-ps1 T A 7: 102,542,380 V148E possibly damaging Het
Olfr58 T G 9: 19,783,576 S148A possibly damaging Het
Olfr632 T C 7: 103,937,503 V41A probably benign Het
Olfr920 A T 9: 38,756,407 T240S probably damaging Het
Olfr980 A T 9: 40,006,742 M69K possibly damaging Het
Orc3 A T 4: 34,571,774 M665K possibly damaging Het
Pabpc1 A G 15: 36,597,011 S591P probably damaging Het
Parp6 T A 9: 59,624,362 probably null Het
Pcdh1 T C 18: 38,189,859 M974V possibly damaging Het
Pcdhb22 T A 18: 37,520,660 V727E possibly damaging Het
Pex5l T C 3: 32,992,985 E272G probably damaging Het
Pglyrp2 G T 17: 32,418,261 N264K probably benign Het
Phxr4 T A 9: 13,431,586 probably benign Het
Piezo2 A G 18: 63,144,954 F293S probably damaging Het
Pkhd1 T C 1: 20,537,401 D1077G probably damaging Het
Plekhs1 A G 19: 56,473,268 probably null Het
Prex1 G T 2: 166,585,857 C788* probably null Het
Prrt3 A T 6: 113,498,138 M41K probably benign Het
Ptgir T C 7: 16,908,843 V326A probably damaging Het
Ptprg T A 14: 12,220,654 D455E probably damaging Het
Ptpru T A 4: 131,799,603 Q686L probably benign Het
Pxdc1 G T 13: 34,630,360 T190K probably benign Het
Rap1b A T 10: 117,818,582 C118S probably benign Het
Rapgef2 T C 3: 79,083,227 M915V probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpe65 C T 3: 159,624,681 A495V probably benign Het
Samd15 A G 12: 87,200,834 T98A possibly damaging Het
Sdk1 T G 5: 141,582,294 D82E probably benign Het
Slc26a7 T C 4: 14,546,309 D340G probably benign Het
Slc6a15 T A 10: 103,418,060 M619K probably benign Het
Slc7a4 C A 16: 17,574,521 D350Y probably damaging Het
Slk T G 19: 47,619,956 N449K probably benign Het
Spta1 A T 1: 174,244,042 probably null Het
Sptbn5 A T 2: 120,055,893 probably benign Het
Srd5a2 A T 17: 74,047,805 V8D probably benign Het
Srgap3 G A 6: 112,727,310 A906V probably benign Het
Stk3 T C 15: 34,999,908 I291V probably benign Het
Supt6 T A 11: 78,208,134 Q1637L possibly damaging Het
Svil T C 18: 5,114,564 F2047S probably damaging Het
Swsap1 A G 9: 21,955,988 E76G probably benign Het
Syndig1 G T 2: 149,899,553 G20C probably damaging Het
Synj2bp A T 12: 81,502,152 N104K probably damaging Het
Synpo2 T A 3: 123,114,419 D416V probably damaging Het
Tacc3 G T 5: 33,672,013 C620F probably damaging Het
Tanc1 A G 2: 59,699,422 E19G probably damaging Het
Tarsl2 C T 7: 65,647,554 A139V probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tdpoz2 T C 3: 93,652,074 H197R possibly damaging Het
Tha1 A T 11: 117,869,379 N300K probably damaging Het
Tm6sf1 T A 7: 81,865,260 F70L probably damaging Het
Tmem132b T A 5: 125,783,433 S581T probably benign Het
Tmem206 A T 1: 191,340,843 I154F probably damaging Het
Tnfsf13 G T 11: 69,685,249 S4* probably null Het
Tonsl G A 15: 76,633,248 S757L probably benign Het
Trem2 G T 17: 48,351,691 R161S possibly damaging Het
Trpm2 A T 10: 77,941,173 V430E probably damaging Het
Ttc14 T A 3: 33,801,369 D154E possibly damaging Het
Ugt2b37 T C 5: 87,250,639 M313V possibly damaging Het
Uhrf1bp1 G A 17: 27,877,394 A107T probably damaging Het
Vmn2r24 A G 6: 123,815,780 I689V probably benign Het
Wdr76 A G 2: 121,542,494 T601A probably benign Het
Xirp1 T C 9: 120,017,003 D938G possibly damaging Het
Zfp608 A T 18: 54,897,969 D966E probably benign Het
Zfp957 A G 14: 79,214,356 M1T probably null Het
Zkscan16 A T 4: 58,957,809 H697L possibly damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 splice site probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 splice site probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
prospector UTSW 10 86901567 splice site probably null
songbird UTSW 10 86858152 missense probably damaging 1.00
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 splice site probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 splice site probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 splice site probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4865:Stab2 UTSW 10 86843500 splice site probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 splice site probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 splice site probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
R7798:Stab2 UTSW 10 86957912 missense probably damaging 0.98
R7835:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7845:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7863:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7885:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7904:Stab2 UTSW 10 86954192 nonsense probably null
R7947:Stab2 UTSW 10 86846033 missense probably benign 0.31
R7963:Stab2 UTSW 10 86848023 critical splice donor site probably null
R8014:Stab2 UTSW 10 86850903 missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86905539 missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86846052 missense probably benign 0.34
R8097:Stab2 UTSW 10 86869095 missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86873864 missense probably damaging 0.98
R8462:Stab2 UTSW 10 86967734 missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86940723 missense probably damaging 1.00
R8692:Stab2 UTSW 10 86972930 missense probably damaging 0.99
R8744:Stab2 UTSW 10 86969349 missense probably benign 0.32
R8745:Stab2 UTSW 10 86969349 missense probably benign 0.32
R8782:Stab2 UTSW 10 86899821 missense probably benign 0.00
R8875:Stab2 UTSW 10 86996864 missense probably damaging 1.00
R8978:Stab2 UTSW 10 86949918 missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86869047 missense probably damaging 1.00
R9248:Stab2 UTSW 10 86891617 missense probably damaging 0.98
R9326:Stab2 UTSW 10 86955146 missense probably damaging 1.00
R9426:Stab2 UTSW 10 86869047 missense probably damaging 1.00
R9568:Stab2 UTSW 10 86863556 missense probably damaging 1.00
R9627:Stab2 UTSW 10 86957840 missense probably damaging 0.98
R9635:Stab2 UTSW 10 86850787 nonsense probably null
R9648:Stab2 UTSW 10 86856697 frame shift probably null
R9649:Stab2 UTSW 10 86856697 frame shift probably null
R9650:Stab2 UTSW 10 86856697 frame shift probably null
R9726:Stab2 UTSW 10 86954231 missense probably benign 0.00
R9756:Stab2 UTSW 10 86967689 missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86922133 missense probably benign 0.03
RF061:Stab2 UTSW 10 86866758 critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86949914 missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86896596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAGAACCTTGGCTCAG -3'
(R):5'- AACTACAAGCATCTGCCTGGG -3'

Sequencing Primer
(F):5'- AACCTTGGCTCAGGGCTGATG -3'
(R):5'- AAGCATCTGCCTGGGGATGG -3'
Posted On 2016-03-01