Incidental Mutation 'R0422:Slc26a3'
ID37143
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Namesolute carrier family 26, member 3
Synonyms9030623B18Rik, 9130013M11Rik, Dra
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R0422 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31390871-31473917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31465849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 583 (T583A)
Ref Sequence ENSEMBL: ENSMUSP00000001254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000171616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001254
AA Change: T583A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225
AA Change: T583A

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31452491 splice site probably benign
IGL01717:Slc26a3 APN 12 31463477 missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31447831 missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31470833 splice site probably benign
IGL02445:Slc26a3 APN 12 31457052 missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31457096 missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31452629 missense probably damaging 1.00
PIT4486001:Slc26a3 UTSW 12 31470950 missense probably benign 0.01
R0544:Slc26a3 UTSW 12 31447740 missense probably benign
R0781:Slc26a3 UTSW 12 31465813 missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31466452 missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31465846 missense probably benign
R1954:Slc26a3 UTSW 12 31450816 missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31465778 missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31457072 missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31470903 missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31464720 missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31453906 missense probably benign 0.00
R3978:Slc26a3 UTSW 12 31465860 splice site probably null
R4701:Slc26a3 UTSW 12 31447774 missense probably damaging 1.00
R4713:Slc26a3 UTSW 12 31457080 missense possibly damaging 0.75
R5024:Slc26a3 UTSW 12 31453908 missense probably benign
R5058:Slc26a3 UTSW 12 31470965 missense possibly damaging 0.66
R5168:Slc26a3 UTSW 12 31468554 missense possibly damaging 0.81
R5361:Slc26a3 UTSW 12 31450981 critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31448843 critical splice donor site probably null
R5951:Slc26a3 UTSW 12 31452715 intron probably benign
R6662:Slc26a3 UTSW 12 31457346 nonsense probably null
R6895:Slc26a3 UTSW 12 31463524 missense probably damaging 0.96
R7069:Slc26a3 UTSW 12 31450935 missense probably damaging 0.96
R7484:Slc26a3 UTSW 12 31447788 missense probably benign 0.22
R7744:Slc26a3 UTSW 12 31463465 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CGTCACATTCTGTAACTCTGAGGATGC -3'
(R):5'- TGCTTTTGATACTTTTCCCAGGACCAA -3'

Sequencing Primer
(F):5'- CTGTAACTCTGAGGATGCTCAGC -3'
(R):5'- ggcaagatggctcagtagg -3'
Posted On2013-05-09