Mutagenetix > Incidental Mutation

Incidental Mutation 'R4825:Ptprg'

371453

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

042441-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4825 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12220654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 455 (D455E)

Ref Sequence

ENSEMBL: ENSMUSP00000113679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022264
AA Change: D1230E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: D1230E

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119888
AA Change: D455E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: D455E

Domain	Start	End	E-Value	Type
PTPc	69	343	1.76e-136	SMART
PTPc	371	634	1.32e-85	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134290

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	A	11: 109,791,672	L229F	probably benign	Het
A930002H24Rik	A	C	17: 63,863,608	S62A	unknown	Het
Abca12	T	A	1: 71,302,685	Q1039L	possibly damaging	Het
Adgrg5	T	A	8: 94,941,734	F476I	possibly damaging	Het
AI314180	G	A	4: 58,850,911	L421F	probably damaging	Het
Alms1	A	G	6: 85,678,245	K2789E	probably damaging	Het
Arrdc2	G	A	8: 70,839,277		probably null	Het
Atp2b1	T	A	10: 99,009,564	I743K	probably damaging	Het
Atp6v1c2	C	T	12: 17,289,060	G230D	probably benign	Het
AU040320	G	A	4: 126,791,793	C54Y	probably damaging	Het
BC024139	C	T	15: 76,120,317	V680I	possibly damaging	Het
Bckdhb	A	G	9: 83,988,905	D156G	probably damaging	Het
Canx	T	A	11: 50,308,809	D143V	probably benign	Het
Ccdc180	T	A	4: 45,912,794	V591E	possibly damaging	Het
Ccno	T	C	13: 112,988,099	S68P	probably benign	Het
Cdc45	C	T	16: 18,784,863	E527K	probably damaging	Het
Cep290	T	A	10: 100,488,348	D14E	probably damaging	Het
Cgnl1	A	G	9: 71,630,524	V1238A	probably benign	Het
Ciz1	C	T	2: 32,371,741	A455V	probably damaging	Het
Coro2b	T	A	9: 62,454,623	Y86F	probably benign	Het
Csf2ra	C	T	19: 61,226,552	R158Q	probably benign	Het
Cubn	A	T	2: 13,325,225	I2615N	probably damaging	Het
Dhx8	C	T	11: 101,738,170	R129*	probably null	Het
Disc1	T	A	8: 125,135,302	M471K	possibly damaging	Het
Dmxl2	G	T	9: 54,404,041	L1799I	probably benign	Het
Dnah2	A	G	11: 69,423,205	S4108P	probably damaging	Het
Ehmt2	C	G	17: 34,906,964	P211R	probably benign	Het
Eif4g3	A	G	4: 138,194,081	D1557G	probably benign	Het
Epha5	T	C	5: 84,233,840	D384G	probably damaging	Het
Etl4	A	G	2: 20,806,927	I1274V	probably damaging	Het
Fam160a1	G	A	3: 85,673,432	P489S	possibly damaging	Het
Fip1l1	G	A	5: 74,588,205		probably null	Het
Fubp1	T	C	3: 152,217,890		probably null	Het
Glul	T	C	1: 153,903,044	V33A	probably benign	Het
Gm4846	A	G	1: 166,491,668	F167S	probably damaging	Het
Heatr6	T	A	11: 83,758,322	L168M	probably damaging	Het
Hif1a	T	A	12: 73,932,401	I233N	probably damaging	Het
Hivep2	T	A	10: 14,131,319	H1220Q	possibly damaging	Het
Igkv8-21	T	C	6: 70,315,426	I9M	probably benign	Het
Izumo1	T	A	7: 45,624,987	C62*	probably null	Het
Jakmip3	G	A	7: 139,026,766	E424K	probably damaging	Het
Klhl2	A	G	8: 64,752,813	V358A	probably damaging	Het
Klk10	C	G	7: 43,783,598	D139E	probably damaging	Het
Klk14	T	C	7: 43,692,076	C51R	probably damaging	Het
Klk5	T	G	7: 43,845,390	I99S	probably damaging	Het
L3hypdh	T	C	12: 72,077,393	T258A	probably benign	Het
Lrp5	A	G	19: 3,614,292	Y812H	probably damaging	Het
Lrrc40	T	A	3: 158,061,330	L474*	probably null	Het
Mkks	A	T	2: 136,880,655	M194K	probably benign	Het
Mmp20	A	G	9: 7,654,120	D347G	probably damaging	Het
Mmp27	A	G	9: 7,581,194	E460G	probably damaging	Het
Mms22l	T	C	4: 24,536,226	F605S	probably damaging	Het
Mpzl3	A	G	9: 45,068,329	S193G	probably benign	Het
Muc4	A	T	16: 32,751,747	T542S	probably benign	Het
Muc5b	T	C	7: 141,868,465	L4446P	possibly damaging	Het
Mxi1	C	A	19: 53,370,338	S131*	probably null	Het
Nanog	G	T	6: 122,713,340	A210S	probably benign	Het
Nrcam	C	T	12: 44,575,986	Q988*	probably null	Het
Nsg1	C	A	5: 38,159,047		probably benign	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1121	T	A	2: 87,372,088	C185*	probably null	Het
Olfr1228	T	C	2: 89,248,690		probably null	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	A	2: 89,978,153	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,314,320		probably null	Het
Olfr548-ps1	T	A	7: 102,542,380	V148E	possibly damaging	Het
Olfr58	T	G	9: 19,783,576	S148A	possibly damaging	Het
Olfr632	T	C	7: 103,937,503	V41A	probably benign	Het
Olfr920	A	T	9: 38,756,407	T240S	probably damaging	Het
Olfr980	A	T	9: 40,006,742	M69K	possibly damaging	Het
Orc3	A	T	4: 34,571,774	M665K	possibly damaging	Het
Pabpc1	A	G	15: 36,597,011	S591P	probably damaging	Het
Parp6	T	A	9: 59,624,362		probably null	Het
Pcdh1	T	C	18: 38,189,859	M974V	possibly damaging	Het
Pcdhb22	T	A	18: 37,520,660	V727E	possibly damaging	Het
Pex5l	T	C	3: 32,992,985	E272G	probably damaging	Het
Pglyrp2	G	T	17: 32,418,261	N264K	probably benign	Het
Phxr4	T	A	9: 13,431,586		probably benign	Het
Piezo2	A	G	18: 63,144,954	F293S	probably damaging	Het
Pkhd1	T	C	1: 20,537,401	D1077G	probably damaging	Het
Plekhs1	A	G	19: 56,473,268		probably null	Het
Prex1	G	T	2: 166,585,857	C788*	probably null	Het
Prrt3	A	T	6: 113,498,138	M41K	probably benign	Het
Ptgir	T	C	7: 16,908,843	V326A	probably damaging	Het
Ptpru	T	A	4: 131,799,603	Q686L	probably benign	Het
Pxdc1	G	T	13: 34,630,360	T190K	probably benign	Het
Rap1b	A	T	10: 117,818,582	C118S	probably benign	Het
Rapgef2	T	C	3: 79,083,227	M915V	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpe65	C	T	3: 159,624,681	A495V	probably benign	Het
Samd15	A	G	12: 87,200,834	T98A	possibly damaging	Het
Sdk1	T	G	5: 141,582,294	D82E	probably benign	Het
Slc26a7	T	C	4: 14,546,309	D340G	probably benign	Het
Slc6a15	T	A	10: 103,418,060	M619K	probably benign	Het
Slc7a4	C	A	16: 17,574,521	D350Y	probably damaging	Het
Slk	T	G	19: 47,619,956	N449K	probably benign	Het
Spta1	A	T	1: 174,244,042		probably null	Het
Sptbn5	A	T	2: 120,055,893		probably benign	Het
Srd5a2	A	T	17: 74,047,805	V8D	probably benign	Het
Srgap3	G	A	6: 112,727,310	A906V	probably benign	Het
Stab2	A	T	10: 86,947,147	M679K	probably benign	Het
Stk3	T	C	15: 34,999,908	I291V	probably benign	Het
Supt6	T	A	11: 78,208,134	Q1637L	possibly damaging	Het
Svil	T	C	18: 5,114,564	F2047S	probably damaging	Het
Swsap1	A	G	9: 21,955,988	E76G	probably benign	Het
Syndig1	G	T	2: 149,899,553	G20C	probably damaging	Het
Synj2bp	A	T	12: 81,502,152	N104K	probably damaging	Het
Synpo2	T	A	3: 123,114,419	D416V	probably damaging	Het
Tacc3	G	T	5: 33,672,013	C620F	probably damaging	Het
Tanc1	A	G	2: 59,699,422	E19G	probably damaging	Het
Tarsl2	C	T	7: 65,647,554	A139V	probably benign	Het
Tbc1d22a	T	A	15: 86,351,734	C365S	probably damaging	Het
Tdpoz2	T	C	3: 93,652,074	H197R	possibly damaging	Het
Tha1	A	T	11: 117,869,379	N300K	probably damaging	Het
Tm6sf1	T	A	7: 81,865,260	F70L	probably damaging	Het
Tmem132b	T	A	5: 125,783,433	S581T	probably benign	Het
Tmem206	A	T	1: 191,340,843	I154F	probably damaging	Het
Tnfsf13	G	T	11: 69,685,249	S4*	probably null	Het
Tonsl	G	A	15: 76,633,248	S757L	probably benign	Het
Trem2	G	T	17: 48,351,691	R161S	possibly damaging	Het
Trpm2	A	T	10: 77,941,173	V430E	probably damaging	Het
Ttc14	T	A	3: 33,801,369	D154E	possibly damaging	Het
Ugt2b37	T	C	5: 87,250,639	M313V	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,877,394	A107T	probably damaging	Het
Vmn2r24	A	G	6: 123,815,780	I689V	probably benign	Het
Wdr76	A	G	2: 121,542,494	T601A	probably benign	Het
Xirp1	T	C	9: 120,017,003	D938G	possibly damaging	Het
Zfp608	A	T	18: 54,897,969	D966E	probably benign	Het
Zfp957	A	G	14: 79,214,356	M1T	probably null	Het
Zkscan16	A	T	4: 58,957,809	H697L	possibly damaging	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
R8860:Ptprg	UTSW	14	12213685	missense	probably damaging	1.00
R8992:Ptprg	UTSW	14	12154170	missense	probably benign	0.00
R9054:Ptprg	UTSW	14	12213638	missense	possibly damaging	0.58
R9587:Ptprg	UTSW	14	12215992	missense	probably damaging	1.00
R9621:Ptprg	UTSW	14	12237809	missense	probably benign
R9625:Ptprg	UTSW	14	12152027	missense	probably damaging	1.00
R9773:Ptprg	UTSW	14	12199806	missense	probably damaging	0.97
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACAGTGCTCACAGAAG -3'
(R):5'- AGCCTCCGTAGCATACACAG -3'

Sequencing Primer
(F):5'- GCACAGTGCTCACAGAAGTACAAC -3'
(R):5'- TCCGTAGCATACACAGGCTCAG -3'

Posted On

2016-03-01