Incidental Mutation 'R4825:Ptprg'
ID371453
Institutional Source Beutler Lab
Gene Symbol Ptprg
Ensembl Gene ENSMUSG00000021745
Gene Nameprotein tyrosine phosphatase, receptor type, G
Synonyms5430405N12Rik, RPTPgamma
MMRRC Submission 042441-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4825 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location11553532-12242041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12220654 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 455 (D455E)
Ref Sequence ENSEMBL: ENSMUSP00000113679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]
Predicted Effect probably damaging
Transcript: ENSMUST00000022264
AA Change: D1230E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: D1230E

DomainStartEndE-ValueType
Carb_anhydrase 60 321 6.38e-109 SMART
FN3 347 433 5.4e-7 SMART
low complexity region 474 484 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
transmembrane domain 734 756 N/A INTRINSIC
PTPc 844 1118 1.76e-136 SMART
PTPc 1146 1409 1.32e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119888
AA Change: D455E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: D455E

DomainStartEndE-ValueType
PTPc 69 343 1.76e-136 SMART
PTPc 371 634 1.32e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134290
Predicted Effect probably benign
Transcript: ENSMUST00000142917
SMART Domains Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

DomainStartEndE-ValueType
Carb_anhydrase 60 260 1.6e-50 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,791,672 L229F probably benign Het
A930002H24Rik A C 17: 63,863,608 S62A unknown Het
Abca12 T A 1: 71,302,685 Q1039L possibly damaging Het
Adgrg5 T A 8: 94,941,734 F476I possibly damaging Het
AI314180 G A 4: 58,850,911 L421F probably damaging Het
Alms1 A G 6: 85,678,245 K2789E probably damaging Het
Arrdc2 G A 8: 70,839,277 probably null Het
Atp2b1 T A 10: 99,009,564 I743K probably damaging Het
Atp6v1c2 C T 12: 17,289,060 G230D probably benign Het
AU040320 G A 4: 126,791,793 C54Y probably damaging Het
BC024139 C T 15: 76,120,317 V680I possibly damaging Het
Bckdhb A G 9: 83,988,905 D156G probably damaging Het
Canx T A 11: 50,308,809 D143V probably benign Het
Ccdc180 T A 4: 45,912,794 V591E possibly damaging Het
Ccno T C 13: 112,988,099 S68P probably benign Het
Cdc45 C T 16: 18,784,863 E527K probably damaging Het
Cep290 T A 10: 100,488,348 D14E probably damaging Het
Cgnl1 A G 9: 71,630,524 V1238A probably benign Het
Ciz1 C T 2: 32,371,741 A455V probably damaging Het
Coro2b T A 9: 62,454,623 Y86F probably benign Het
Csf2ra C T 19: 61,226,552 R158Q probably benign Het
Cubn A T 2: 13,325,225 I2615N probably damaging Het
Dhx8 C T 11: 101,738,170 R129* probably null Het
Disc1 T A 8: 125,135,302 M471K possibly damaging Het
Dmxl2 G T 9: 54,404,041 L1799I probably benign Het
Dnah2 A G 11: 69,423,205 S4108P probably damaging Het
Ehmt2 C G 17: 34,906,964 P211R probably benign Het
Eif4g3 A G 4: 138,194,081 D1557G probably benign Het
Epha5 T C 5: 84,233,840 D384G probably damaging Het
Etl4 A G 2: 20,806,927 I1274V probably damaging Het
Fam160a1 G A 3: 85,673,432 P489S possibly damaging Het
Fip1l1 G A 5: 74,588,205 probably null Het
Fubp1 T C 3: 152,217,890 probably null Het
Glul T C 1: 153,903,044 V33A probably benign Het
Gm4846 A G 1: 166,491,668 F167S probably damaging Het
Heatr6 T A 11: 83,758,322 L168M probably damaging Het
Hif1a T A 12: 73,932,401 I233N probably damaging Het
Hivep2 T A 10: 14,131,319 H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,315,426 I9M probably benign Het
Izumo1 T A 7: 45,624,987 C62* probably null Het
Jakmip3 G A 7: 139,026,766 E424K probably damaging Het
Klhl2 A G 8: 64,752,813 V358A probably damaging Het
Klk10 C G 7: 43,783,598 D139E probably damaging Het
Klk14 T C 7: 43,692,076 C51R probably damaging Het
Klk5 T G 7: 43,845,390 I99S probably damaging Het
L3hypdh T C 12: 72,077,393 T258A probably benign Het
Lrp5 A G 19: 3,614,292 Y812H probably damaging Het
Lrrc40 T A 3: 158,061,330 L474* probably null Het
Mkks A T 2: 136,880,655 M194K probably benign Het
Mmp20 A G 9: 7,654,120 D347G probably damaging Het
Mmp27 A G 9: 7,581,194 E460G probably damaging Het
Mms22l T C 4: 24,536,226 F605S probably damaging Het
Mpzl3 A G 9: 45,068,329 S193G probably benign Het
Muc4 A T 16: 32,751,747 T542S probably benign Het
Muc5b T C 7: 141,868,465 L4446P possibly damaging Het
Mxi1 C A 19: 53,370,338 S131* probably null Het
Nanog G T 6: 122,713,340 A210S probably benign Het
Nrcam C T 12: 44,575,986 Q988* probably null Het
Nsg1 C A 5: 38,159,047 probably benign Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1121 T A 2: 87,372,088 C185* probably null Het
Olfr1228 T C 2: 89,248,690 probably null Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G A 2: 89,978,153 C125Y probably damaging Het
Olfr1465 A T 19: 13,314,320 probably null Het
Olfr548-ps1 T A 7: 102,542,380 V148E possibly damaging Het
Olfr58 T G 9: 19,783,576 S148A possibly damaging Het
Olfr632 T C 7: 103,937,503 V41A probably benign Het
Olfr920 A T 9: 38,756,407 T240S probably damaging Het
Olfr980 A T 9: 40,006,742 M69K possibly damaging Het
Orc3 A T 4: 34,571,774 M665K possibly damaging Het
Pabpc1 A G 15: 36,597,011 S591P probably damaging Het
Parp6 T A 9: 59,624,362 probably null Het
Pcdh1 T C 18: 38,189,859 M974V possibly damaging Het
Pcdhb22 T A 18: 37,520,660 V727E possibly damaging Het
Pex5l T C 3: 32,992,985 E272G probably damaging Het
Pglyrp2 G T 17: 32,418,261 N264K probably benign Het
Phxr4 T A 9: 13,431,586 probably benign Het
Piezo2 A G 18: 63,144,954 F293S probably damaging Het
Pkhd1 T C 1: 20,537,401 D1077G probably damaging Het
Plekhs1 A G 19: 56,473,268 probably null Het
Prex1 G T 2: 166,585,857 C788* probably null Het
Prrt3 A T 6: 113,498,138 M41K probably benign Het
Ptgir T C 7: 16,908,843 V326A probably damaging Het
Ptpru T A 4: 131,799,603 Q686L probably benign Het
Pxdc1 G T 13: 34,630,360 T190K probably benign Het
Rap1b A T 10: 117,818,582 C118S probably benign Het
Rapgef2 T C 3: 79,083,227 M915V probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpe65 C T 3: 159,624,681 A495V probably benign Het
Samd15 A G 12: 87,200,834 T98A possibly damaging Het
Sdk1 T G 5: 141,582,294 D82E probably benign Het
Slc26a7 T C 4: 14,546,309 D340G probably benign Het
Slc6a15 T A 10: 103,418,060 M619K probably benign Het
Slc7a4 C A 16: 17,574,521 D350Y probably damaging Het
Slk T G 19: 47,619,956 N449K probably benign Het
Spta1 A T 1: 174,244,042 probably null Het
Sptbn5 A T 2: 120,055,893 probably benign Het
Srd5a2 A T 17: 74,047,805 V8D probably benign Het
Srgap3 G A 6: 112,727,310 A906V probably benign Het
Stab2 A T 10: 86,947,147 M679K probably benign Het
Stk3 T C 15: 34,999,908 I291V probably benign Het
Supt6 T A 11: 78,208,134 Q1637L possibly damaging Het
Svil T C 18: 5,114,564 F2047S probably damaging Het
Swsap1 A G 9: 21,955,988 E76G probably benign Het
Syndig1 G T 2: 149,899,553 G20C probably damaging Het
Synj2bp A T 12: 81,502,152 N104K probably damaging Het
Synpo2 T A 3: 123,114,419 D416V probably damaging Het
Tacc3 G T 5: 33,672,013 C620F probably damaging Het
Tanc1 A G 2: 59,699,422 E19G probably damaging Het
Tarsl2 C T 7: 65,647,554 A139V probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tdpoz2 T C 3: 93,652,074 H197R possibly damaging Het
Tha1 A T 11: 117,869,379 N300K probably damaging Het
Tm6sf1 T A 7: 81,865,260 F70L probably damaging Het
Tmem132b T A 5: 125,783,433 S581T probably benign Het
Tmem206 A T 1: 191,340,843 I154F probably damaging Het
Tnfsf13 G T 11: 69,685,249 S4* probably null Het
Tonsl G A 15: 76,633,248 S757L probably benign Het
Trem2 G T 17: 48,351,691 R161S possibly damaging Het
Trpm2 A T 10: 77,941,173 V430E probably damaging Het
Ttc14 T A 3: 33,801,369 D154E possibly damaging Het
Ugt2b37 T C 5: 87,250,639 M313V possibly damaging Het
Uhrf1bp1 G A 17: 27,877,394 A107T probably damaging Het
Vmn2r24 A G 6: 123,815,780 I689V probably benign Het
Wdr76 A G 2: 121,542,494 T601A probably benign Het
Xirp1 T C 9: 120,017,003 D938G possibly damaging Het
Zfp608 A T 18: 54,897,969 D966E probably benign Het
Zfp957 A G 14: 79,214,356 M1T probably null Het
Zkscan16 A T 4: 58,957,809 H697L possibly damaging Het
Other mutations in Ptprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ptprg APN 14 12215992 missense probably damaging 1.00
IGL00484:Ptprg APN 14 12215220 missense probably damaging 0.99
IGL00847:Ptprg APN 14 12215265 missense probably damaging 1.00
IGL01089:Ptprg APN 14 12215286 missense probably damaging 0.97
IGL01382:Ptprg APN 14 12237797 missense probably benign 0.16
IGL01470:Ptprg APN 14 12213702 nonsense probably null
IGL01762:Ptprg APN 14 12037386 missense probably benign 0.00
IGL01886:Ptprg APN 14 12179280 missense probably benign 0.22
IGL01963:Ptprg APN 14 12220661 missense probably damaging 1.00
IGL02015:Ptprg APN 14 12237782 missense possibly damaging 0.46
IGL02086:Ptprg APN 14 12110080 nonsense probably null
IGL02197:Ptprg APN 14 12220613 missense probably damaging 0.98
IGL02341:Ptprg APN 14 12154360 missense probably benign 0.00
IGL02732:Ptprg APN 14 12225617 critical splice donor site probably null
IGL03011:Ptprg APN 14 12219029 missense probably damaging 1.00
IGL03261:Ptprg APN 14 12225552 missense probably damaging 0.99
R0038:Ptprg UTSW 14 12213710 missense probably damaging 1.00
R0383:Ptprg UTSW 14 12219024 missense possibly damaging 0.93
R0433:Ptprg UTSW 14 12220620 missense probably damaging 1.00
R0488:Ptprg UTSW 14 12220653 missense probably damaging 1.00
R0503:Ptprg UTSW 14 12237138 missense possibly damaging 0.89
R0520:Ptprg UTSW 14 12199783 missense possibly damaging 0.92
R0570:Ptprg UTSW 14 12215896 missense probably damaging 1.00
R0606:Ptprg UTSW 14 12154131 missense probably benign
R1086:Ptprg UTSW 14 11952706 splice site probably benign
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1519:Ptprg UTSW 14 12220596 missense probably damaging 1.00
R1662:Ptprg UTSW 14 12207357 missense probably damaging 1.00
R1714:Ptprg UTSW 14 12213697 missense probably damaging 1.00
R1716:Ptprg UTSW 14 12154360 missense probably benign 0.00
R1797:Ptprg UTSW 14 12199743 missense probably damaging 1.00
R1803:Ptprg UTSW 14 12091410 splice site probably null
R2104:Ptprg UTSW 14 11952897 critical splice donor site probably null
R2125:Ptprg UTSW 14 12179283 missense possibly damaging 0.74
R2126:Ptprg UTSW 14 12154355 missense probably benign
R2133:Ptprg UTSW 14 12211637 missense probably damaging 1.00
R2471:Ptprg UTSW 14 12210327 missense probably damaging 1.00
R2571:Ptprg UTSW 14 12122135 missense probably benign
R3821:Ptprg UTSW 14 12226375 missense probably benign 0.00
R4196:Ptprg UTSW 14 12122002 missense possibly damaging 0.51
R4392:Ptprg UTSW 14 12142467 missense possibly damaging 0.80
R4665:Ptprg UTSW 14 12215288 missense possibly damaging 0.90
R4730:Ptprg UTSW 14 12213713 missense probably damaging 1.00
R4737:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R4764:Ptprg UTSW 14 12122068 missense probably benign 0.01
R4801:Ptprg UTSW 14 11554233 utr 5 prime probably benign
R4960:Ptprg UTSW 14 12237837 missense probably benign 0.07
R4972:Ptprg UTSW 14 12226427 missense possibly damaging 0.94
R4980:Ptprg UTSW 14 12154421 missense probably benign 0.16
R5004:Ptprg UTSW 14 12220667 missense probably damaging 1.00
R5058:Ptprg UTSW 14 12037387 missense possibly damaging 0.82
R5182:Ptprg UTSW 14 12154174 missense probably benign
R5258:Ptprg UTSW 14 12142431 missense probably benign 0.11
R5338:Ptprg UTSW 14 12154111 missense probably benign
R5353:Ptprg UTSW 14 11554235 utr 5 prime probably benign
R5373:Ptprg UTSW 14 12213665 missense probably benign 0.00
R5387:Ptprg UTSW 14 12153873 missense probably damaging 1.00
R5616:Ptprg UTSW 14 12122120 missense probably benign
R5623:Ptprg UTSW 14 12153857 missense probably damaging 1.00
R5976:Ptprg UTSW 14 12211625 missense probably damaging 0.96
R6027:Ptprg UTSW 14 12220613 missense possibly damaging 0.87
R6091:Ptprg UTSW 14 12215979 missense probably damaging 1.00
R6184:Ptprg UTSW 14 12153943 missense probably benign 0.00
R6234:Ptprg UTSW 14 12213747 missense probably damaging 1.00
R6318:Ptprg UTSW 14 12237118 missense probably damaging 1.00
R6324:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R6334:Ptprg UTSW 14 12166832 missense probably damaging 1.00
R6646:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6647:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6992:Ptprg UTSW 14 11962602 missense probably damaging 1.00
R7088:Ptprg UTSW 14 12207365 missense probably damaging 1.00
R7250:Ptprg UTSW 14 12166767 missense probably benign 0.18
R7342:Ptprg UTSW 14 12237151 missense possibly damaging 0.90
R7358:Ptprg UTSW 14 12154198 missense possibly damaging 0.59
R7410:Ptprg UTSW 14 11962657 missense probably damaging 1.00
R7448:Ptprg UTSW 14 12142461 missense probably benign 0.12
R7514:Ptprg UTSW 14 12179342 missense possibly damaging 0.86
R7523:Ptprg UTSW 14 12237130 missense probably damaging 0.97
R7672:Ptprg UTSW 14 12211668 missense probably benign 0.04
R7709:Ptprg UTSW 14 12226452 missense probably damaging 1.00
R7720:Ptprg UTSW 14 12211703 missense probably benign 0.31
X0020:Ptprg UTSW 14 12110070 frame shift probably null
X0027:Ptprg UTSW 14 12110070 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCACAGTGCTCACAGAAG -3'
(R):5'- AGCCTCCGTAGCATACACAG -3'

Sequencing Primer
(F):5'- GCACAGTGCTCACAGAAGTACAAC -3'
(R):5'- TCCGTAGCATACACAGGCTCAG -3'
Posted On2016-03-01