Mutagenetix > Incidental Mutation

Incidental Mutation 'R4825:Piezo2'

371474

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

042441-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4825 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63144954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 293 (F293S)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046860
AA Change: F293S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: F293S

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: F293S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: F293S

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000182166
AA Change: F185S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182177

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182233
AA Change: F61S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: F61S

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183217
AA Change: F293S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: F293S

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	A	11: 109,791,672	L229F	probably benign	Het
A930002H24Rik	A	C	17: 63,863,608	S62A	unknown	Het
Abca12	T	A	1: 71,302,685	Q1039L	possibly damaging	Het
Adgrg5	T	A	8: 94,941,734	F476I	possibly damaging	Het
AI314180	G	A	4: 58,850,911	L421F	probably damaging	Het
Alms1	A	G	6: 85,678,245	K2789E	probably damaging	Het
Arrdc2	G	A	8: 70,839,277		probably null	Het
Atp2b1	T	A	10: 99,009,564	I743K	probably damaging	Het
Atp6v1c2	C	T	12: 17,289,060	G230D	probably benign	Het
AU040320	G	A	4: 126,791,793	C54Y	probably damaging	Het
BC024139	C	T	15: 76,120,317	V680I	possibly damaging	Het
Bckdhb	A	G	9: 83,988,905	D156G	probably damaging	Het
Canx	T	A	11: 50,308,809	D143V	probably benign	Het
Ccdc180	T	A	4: 45,912,794	V591E	possibly damaging	Het
Ccno	T	C	13: 112,988,099	S68P	probably benign	Het
Cdc45	C	T	16: 18,784,863	E527K	probably damaging	Het
Cep290	T	A	10: 100,488,348	D14E	probably damaging	Het
Cgnl1	A	G	9: 71,630,524	V1238A	probably benign	Het
Ciz1	C	T	2: 32,371,741	A455V	probably damaging	Het
Coro2b	T	A	9: 62,454,623	Y86F	probably benign	Het
Csf2ra	C	T	19: 61,226,552	R158Q	probably benign	Het
Cubn	A	T	2: 13,325,225	I2615N	probably damaging	Het
Dhx8	C	T	11: 101,738,170	R129*	probably null	Het
Disc1	T	A	8: 125,135,302	M471K	possibly damaging	Het
Dmxl2	G	T	9: 54,404,041	L1799I	probably benign	Het
Dnah2	A	G	11: 69,423,205	S4108P	probably damaging	Het
Ehmt2	C	G	17: 34,906,964	P211R	probably benign	Het
Eif4g3	A	G	4: 138,194,081	D1557G	probably benign	Het
Epha5	T	C	5: 84,233,840	D384G	probably damaging	Het
Etl4	A	G	2: 20,806,927	I1274V	probably damaging	Het
Fam160a1	G	A	3: 85,673,432	P489S	possibly damaging	Het
Fip1l1	G	A	5: 74,588,205		probably null	Het
Fubp1	T	C	3: 152,217,890		probably null	Het
Glul	T	C	1: 153,903,044	V33A	probably benign	Het
Gm4846	A	G	1: 166,491,668	F167S	probably damaging	Het
Heatr6	T	A	11: 83,758,322	L168M	probably damaging	Het
Hif1a	T	A	12: 73,932,401	I233N	probably damaging	Het
Hivep2	T	A	10: 14,131,319	H1220Q	possibly damaging	Het
Igkv8-21	T	C	6: 70,315,426	I9M	probably benign	Het
Izumo1	T	A	7: 45,624,987	C62*	probably null	Het
Jakmip3	G	A	7: 139,026,766	E424K	probably damaging	Het
Klhl2	A	G	8: 64,752,813	V358A	probably damaging	Het
Klk10	C	G	7: 43,783,598	D139E	probably damaging	Het
Klk14	T	C	7: 43,692,076	C51R	probably damaging	Het
Klk5	T	G	7: 43,845,390	I99S	probably damaging	Het
L3hypdh	T	C	12: 72,077,393	T258A	probably benign	Het
Lrp5	A	G	19: 3,614,292	Y812H	probably damaging	Het
Lrrc40	T	A	3: 158,061,330	L474*	probably null	Het
Mkks	A	T	2: 136,880,655	M194K	probably benign	Het
Mmp20	A	G	9: 7,654,120	D347G	probably damaging	Het
Mmp27	A	G	9: 7,581,194	E460G	probably damaging	Het
Mms22l	T	C	4: 24,536,226	F605S	probably damaging	Het
Mpzl3	A	G	9: 45,068,329	S193G	probably benign	Het
Muc4	A	T	16: 32,751,747	T542S	probably benign	Het
Muc5b	T	C	7: 141,868,465	L4446P	possibly damaging	Het
Mxi1	C	A	19: 53,370,338	S131*	probably null	Het
Nanog	G	T	6: 122,713,340	A210S	probably benign	Het
Nrcam	C	T	12: 44,575,986	Q988*	probably null	Het
Nsg1	C	A	5: 38,159,047		probably benign	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1121	T	A	2: 87,372,088	C185*	probably null	Het
Olfr1228	T	C	2: 89,248,690		probably null	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	A	2: 89,978,153	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,314,320		probably null	Het
Olfr548-ps1	T	A	7: 102,542,380	V148E	possibly damaging	Het
Olfr58	T	G	9: 19,783,576	S148A	possibly damaging	Het
Olfr632	T	C	7: 103,937,503	V41A	probably benign	Het
Olfr920	A	T	9: 38,756,407	T240S	probably damaging	Het
Olfr980	A	T	9: 40,006,742	M69K	possibly damaging	Het
Orc3	A	T	4: 34,571,774	M665K	possibly damaging	Het
Pabpc1	A	G	15: 36,597,011	S591P	probably damaging	Het
Parp6	T	A	9: 59,624,362		probably null	Het
Pcdh1	T	C	18: 38,189,859	M974V	possibly damaging	Het
Pcdhb22	T	A	18: 37,520,660	V727E	possibly damaging	Het
Pex5l	T	C	3: 32,992,985	E272G	probably damaging	Het
Pglyrp2	G	T	17: 32,418,261	N264K	probably benign	Het
Phxr4	T	A	9: 13,431,586		probably benign	Het
Pkhd1	T	C	1: 20,537,401	D1077G	probably damaging	Het
Plekhs1	A	G	19: 56,473,268		probably null	Het
Prex1	G	T	2: 166,585,857	C788*	probably null	Het
Prrt3	A	T	6: 113,498,138	M41K	probably benign	Het
Ptgir	T	C	7: 16,908,843	V326A	probably damaging	Het
Ptprg	T	A	14: 12,220,654	D455E	probably damaging	Het
Ptpru	T	A	4: 131,799,603	Q686L	probably benign	Het
Pxdc1	G	T	13: 34,630,360	T190K	probably benign	Het
Rap1b	A	T	10: 117,818,582	C118S	probably benign	Het
Rapgef2	T	C	3: 79,083,227	M915V	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpe65	C	T	3: 159,624,681	A495V	probably benign	Het
Samd15	A	G	12: 87,200,834	T98A	possibly damaging	Het
Sdk1	T	G	5: 141,582,294	D82E	probably benign	Het
Slc26a7	T	C	4: 14,546,309	D340G	probably benign	Het
Slc6a15	T	A	10: 103,418,060	M619K	probably benign	Het
Slc7a4	C	A	16: 17,574,521	D350Y	probably damaging	Het
Slk	T	G	19: 47,619,956	N449K	probably benign	Het
Spta1	A	T	1: 174,244,042		probably null	Het
Sptbn5	A	T	2: 120,055,893		probably benign	Het
Srd5a2	A	T	17: 74,047,805	V8D	probably benign	Het
Srgap3	G	A	6: 112,727,310	A906V	probably benign	Het
Stab2	A	T	10: 86,947,147	M679K	probably benign	Het
Stk3	T	C	15: 34,999,908	I291V	probably benign	Het
Supt6	T	A	11: 78,208,134	Q1637L	possibly damaging	Het
Svil	T	C	18: 5,114,564	F2047S	probably damaging	Het
Swsap1	A	G	9: 21,955,988	E76G	probably benign	Het
Syndig1	G	T	2: 149,899,553	G20C	probably damaging	Het
Synj2bp	A	T	12: 81,502,152	N104K	probably damaging	Het
Synpo2	T	A	3: 123,114,419	D416V	probably damaging	Het
Tacc3	G	T	5: 33,672,013	C620F	probably damaging	Het
Tanc1	A	G	2: 59,699,422	E19G	probably damaging	Het
Tarsl2	C	T	7: 65,647,554	A139V	probably benign	Het
Tbc1d22a	T	A	15: 86,351,734	C365S	probably damaging	Het
Tdpoz2	T	C	3: 93,652,074	H197R	possibly damaging	Het
Tha1	A	T	11: 117,869,379	N300K	probably damaging	Het
Tm6sf1	T	A	7: 81,865,260	F70L	probably damaging	Het
Tmem132b	T	A	5: 125,783,433	S581T	probably benign	Het
Tmem206	A	T	1: 191,340,843	I154F	probably damaging	Het
Tnfsf13	G	T	11: 69,685,249	S4*	probably null	Het
Tonsl	G	A	15: 76,633,248	S757L	probably benign	Het
Trem2	G	T	17: 48,351,691	R161S	possibly damaging	Het
Trpm2	A	T	10: 77,941,173	V430E	probably damaging	Het
Ttc14	T	A	3: 33,801,369	D154E	possibly damaging	Het
Ugt2b37	T	C	5: 87,250,639	M313V	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,877,394	A107T	probably damaging	Het
Vmn2r24	A	G	6: 123,815,780	I689V	probably benign	Het
Wdr76	A	G	2: 121,542,494	T601A	probably benign	Het
Xirp1	T	C	9: 120,017,003	D938G	possibly damaging	Het
Zfp608	A	T	18: 54,897,969	D966E	probably benign	Het
Zfp957	A	G	14: 79,214,356	M1T	probably null	Het
Zkscan16	A	T	4: 58,957,809	H697L	possibly damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAGACTGCTTCCCTGCTGTG -3'
(R):5'- AATTCACCGAGTGACAAGCATCG -3'

Sequencing Primer
(F):5'- GTGCCAAACCTCTGCTTAATG -3'
(R):5'- AGTGACAAGCATCGTCCTGTC -3'

Posted On

2016-03-01