Incidental Mutation 'R0422:Ap3b1'
ID 37148
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission 038624-MU
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene? Possibly non essential (E-score: 0.408) question?
Stock # R0422 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 94358960-94566317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94462460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 514 (I514T)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably damaging
Transcript: ENSMUST00000022196
AA Change: I514T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: I514T

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451087 critical splice donor site probably benign
cuttlefish UTSW 13 94448451 critical splice acceptor site probably null
Gastropod UTSW 13 94542840 missense unknown
razor UTSW 13 94493731 missense unknown
Slime UTSW 13 94404078 missense possibly damaging 0.51
slug UTSW 13 94408845 critical splice donor site probably null
snail UTSW 13 94479885 splice site probably benign
stalk UTSW 13 94472931 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94408845 critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8876:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94472931 critical splice donor site probably null
R9152:Ap3b1 UTSW 13 94493731 missense unknown
R9166:Ap3b1 UTSW 13 94471728 missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94448451 critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94404062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGCCGTAGCAGCTCCTAAAG -3'
(R):5'- TCAACCGTAGGACCTAGTACAGCAG -3'

Sequencing Primer
(F):5'- CGTAGCAGCTCCTAAAGGAATG -3'
(R):5'- CCTAGTACAGCAGGGTGCAG -3'
Posted On 2013-05-09