Incidental Mutation 'R4838:Pkp1'
ID371486
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R4838 (G1)
Quality Score221
Status Not validated
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135882588 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 415 (S415G)
Ref Sequence ENSEMBL: ENSMUSP00000128418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably damaging
Transcript: ENSMUST00000027667
AA Change: S415G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: S415G

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132793
Predicted Effect probably damaging
Transcript: ENSMUST00000163260
AA Change: S415G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: S415G

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189805
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0180:Pkp1 UTSW 1 135886800 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0368:Pkp1 UTSW 1 135886852 missense probably benign 0.00
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R0725:Pkp1 UTSW 1 135880740 missense probably benign 0.02
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2190:Pkp1 UTSW 1 135879971 missense probably benign 0.02
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R5908:Pkp1 UTSW 1 135918883 nonsense probably null
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R6232:Pkp1 UTSW 1 135886861 missense probably benign 0.01
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTATAGGCACAGACCACAGG -3'
(R):5'- CCAATTGAGTTCAGGAGGAGAC -3'

Sequencing Primer
(F):5'- GGTCGGGGATAGAGGTGTCAC -3'
(R):5'- GCAGATGCGGCTGAATCTTTTCC -3'
Posted On2016-03-01