Incidental Mutation 'R4838:Csmd2'
ID 371505
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R4838 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128411542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 2520 (H2520R)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: H2520R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,944,523 (GRCm39) V386A probably benign Het
Adk G A 14: 21,419,154 (GRCm39) A247T probably damaging Het
Ankrd27 T A 7: 35,291,231 (GRCm39) L9Q possibly damaging Het
Atad2 A G 15: 57,966,679 (GRCm39) L638P probably damaging Het
Atf7ip T A 6: 136,573,489 (GRCm39) D1009E probably benign Het
Bend7 A T 2: 4,749,133 (GRCm39) K83N probably damaging Het
Bicc1 C T 10: 70,781,146 (GRCm39) D562N possibly damaging Het
Calcrl T A 2: 84,181,549 (GRCm39) N200Y probably damaging Het
Ccdc125 C A 13: 100,814,453 (GRCm39) A11E possibly damaging Het
Cd5l A G 3: 87,273,258 (GRCm39) T76A probably benign Het
Cdhr5 A T 7: 140,853,644 (GRCm39) I2N probably damaging Het
Cdk10 C T 8: 123,957,353 (GRCm39) A230V probably damaging Het
Cep128 T C 12: 90,966,319 (GRCm39) probably benign Het
Cep131 T C 11: 119,966,982 (GRCm39) N186D probably damaging Het
Cfhr4 T A 1: 139,661,181 (GRCm39) D556V probably damaging Het
Cog7 G T 7: 121,570,604 (GRCm39) P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 (GRCm39) M949L probably benign Het
Coq8b T A 7: 26,950,016 (GRCm39) M365K probably damaging Het
Cpa1 A G 6: 30,639,515 (GRCm39) E18G possibly damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Dpm1 G A 2: 168,052,456 (GRCm39) T260I probably damaging Het
Dtx3 A T 10: 127,027,176 (GRCm39) probably null Het
Eepd1 T C 9: 25,500,756 (GRCm39) V401A possibly damaging Het
Ehhadh A G 16: 21,581,952 (GRCm39) S347P possibly damaging Het
Elp3 A G 14: 65,785,313 (GRCm39) probably null Het
Enam C T 5: 88,640,967 (GRCm39) Q210* probably null Het
Epha1 C T 6: 42,340,750 (GRCm39) R607H probably benign Het
Erich6 A G 3: 58,544,251 (GRCm39) I112T probably benign Het
F830045P16Rik A G 2: 129,302,470 (GRCm39) V374A possibly damaging Het
Fam171a2 C A 11: 102,329,511 (GRCm39) R416L possibly damaging Het
Fbn1 T C 2: 125,214,319 (GRCm39) N764S probably benign Het
Fip1l1 C T 5: 74,752,600 (GRCm39) T469I probably damaging Het
Flad1 G A 3: 89,313,217 (GRCm39) R342C probably damaging Het
Fzd3 A G 14: 65,477,269 (GRCm39) V95A probably benign Het
Garem1 T C 18: 21,280,950 (GRCm39) T469A probably benign Het
Gm17093 A G 14: 44,755,805 (GRCm39) Y24C unknown Het
Grap2 T C 15: 80,522,762 (GRCm39) V96A possibly damaging Het
Greb1 A T 12: 16,734,361 (GRCm39) probably null Het
Grid2ip A T 5: 143,374,530 (GRCm39) K913* probably null Het
Gzmk T C 13: 113,309,555 (GRCm39) D126G probably damaging Het
Hibch A G 1: 52,924,337 (GRCm39) I171V possibly damaging Het
Hipk2 G T 6: 38,795,339 (GRCm39) T310K possibly damaging Het
Hk3 T C 13: 55,154,231 (GRCm39) Y815C probably damaging Het
Hps5 A T 7: 46,437,778 (GRCm39) V99E probably damaging Het
Hspg2 A G 4: 137,268,977 (GRCm39) H2203R possibly damaging Het
Il12rb2 A G 6: 67,286,121 (GRCm39) V108A probably damaging Het
Il6st C T 13: 112,627,044 (GRCm39) R279* probably null Het
Kdm2a A C 19: 4,375,054 (GRCm39) S692R probably benign Het
Kif13a T C 13: 46,980,224 (GRCm39) K176R probably damaging Het
Kif5b T C 18: 6,216,869 (GRCm39) K485E probably damaging Het
Ktn1 C T 14: 47,963,413 (GRCm39) R1111* probably null Het
Lrrc23 A T 6: 124,755,152 (GRCm39) N128K probably benign Het
Mad1l1 G A 5: 140,286,017 (GRCm39) Q293* probably null Het
Man1b1 A T 2: 25,235,487 (GRCm39) I338F possibly damaging Het
Marchf1 G T 8: 66,921,015 (GRCm39) V225L probably damaging Het
Matcap2 A T 9: 22,335,673 (GRCm39) D97V probably damaging Het
Mrpl3 A G 9: 104,934,231 (GRCm39) D118G probably damaging Het
Nomo1 A T 7: 45,733,139 (GRCm39) Q1209L unknown Het
Nrcam A G 12: 44,620,802 (GRCm39) E949G probably damaging Het
Olfm5 T G 7: 103,803,572 (GRCm39) N297T probably damaging Het
Or51h7 T A 7: 102,591,453 (GRCm39) L110F probably damaging Het
Pcdh7 A T 5: 57,878,146 (GRCm39) N567I probably damaging Het
Pkn1 A G 8: 84,404,595 (GRCm39) L495P probably damaging Het
Pkp1 T C 1: 135,810,326 (GRCm39) S415G probably damaging Het
Pou2f1 T A 1: 165,744,492 (GRCm39) Q53L probably null Het
Pramel26 G A 4: 143,537,375 (GRCm39) Q319* probably null Het
Prkce A G 17: 86,937,511 (GRCm39) K648R probably benign Het
Ptprh G A 7: 4,576,429 (GRCm39) T277I possibly damaging Het
Rpl31 C T 1: 39,410,048 (GRCm39) R83C probably benign Het
Rpusd3 G A 6: 113,393,837 (GRCm39) Q194* probably null Het
Sgsm1 T A 5: 113,430,492 (GRCm39) N298Y probably damaging Het
She G A 3: 89,758,946 (GRCm39) G355D probably benign Het
Shld2 A G 14: 33,990,582 (GRCm39) V108A probably benign Het
Snx11 C T 11: 96,665,284 (GRCm39) E9K possibly damaging Het
Soat1 C A 1: 156,260,507 (GRCm39) A444S probably benign Het
Sox6 T C 7: 115,085,897 (GRCm39) Y690C probably damaging Het
Spata13 T A 14: 60,970,628 (GRCm39) F10I probably benign Het
St18 C A 1: 6,873,129 (GRCm39) T288K probably benign Het
Tifa C T 3: 127,590,235 (GRCm39) S2F probably damaging Het
Tmem232 A T 17: 65,737,883 (GRCm39) S392R probably benign Het
Tmtc3 T C 10: 100,302,082 (GRCm39) N289S probably damaging Het
Tpo A G 12: 30,142,633 (GRCm39) F697S probably damaging Het
Trp53 A G 11: 69,478,456 (GRCm39) T122A probably damaging Het
Trps1 A C 15: 50,690,712 (GRCm39) I10S probably benign Het
Tubgcp5 C T 7: 55,443,933 (GRCm39) probably benign Het
Unc13c T G 9: 73,839,354 (GRCm39) Y499S possibly damaging Het
Unc45a C A 7: 79,982,783 (GRCm39) D381Y probably damaging Het
Upf1 G C 8: 70,792,018 (GRCm39) H402Q probably benign Het
Uroc1 A T 6: 90,326,174 (GRCm39) I510F possibly damaging Het
Usp15 A G 10: 122,963,662 (GRCm39) F589L probably damaging Het
Vmn2r76 T C 7: 85,874,733 (GRCm39) Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 (GRCm39) N151D probably benign Het
Zbtb40 A T 4: 136,728,527 (GRCm39) S439T probably benign Het
Zbtb6 A T 2: 37,318,728 (GRCm39) L400* probably null Het
Zfp125 C T 12: 20,949,961 (GRCm39) noncoding transcript Het
Zmynd8 A C 2: 165,681,954 (GRCm39) Y183* probably null Het
Zpld2 A G 4: 133,920,410 (GRCm39) V585A probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTGGTACATGAACACCCCTC -3'
(R):5'- CAGGGGTCAGTTTGCTTGACTC -3'

Sequencing Primer
(F):5'- TACATGAACACCCCTCCACCAAG -3'
(R):5'- TTTTGGAGCTGGACCCCACAC -3'
Posted On 2016-03-01