Incidental Mutation 'R4838:Zbtb40'
ID371508
Institutional Source Beutler Lab
Gene Symbol Zbtb40
Ensembl Gene ENSMUSG00000060862
Gene Namezinc finger and BTB domain containing 40
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136979732-137048801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137001216 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 439 (S439T)
Ref Sequence ENSEMBL: ENSMUSP00000061899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049583]
Predicted Effect probably benign
Transcript: ENSMUST00000049583
AA Change: S439T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: S439T

DomainStartEndE-ValueType
low complexity region 8 14 N/A INTRINSIC
BTB 24 117 3.39e-18 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 525 533 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
ZnF_C2H2 754 774 4.86e1 SMART
low complexity region 786 801 N/A INTRINSIC
ZnF_C2H2 825 848 1.16e-1 SMART
ZnF_C2H2 854 876 1.1e-2 SMART
ZnF_C2H2 882 905 1.16e-1 SMART
ZnF_C2H2 911 933 1.2e-3 SMART
ZnF_C2H2 939 962 8.81e-2 SMART
ZnF_C2H2 969 992 7.05e-1 SMART
ZnF_C2H2 997 1019 1.47e-3 SMART
ZnF_C2H2 1025 1047 2.86e-1 SMART
ZnF_C2H2 1065 1088 6.67e-2 SMART
ZnF_C2H2 1094 1117 6.23e-2 SMART
ZnF_C2H2 1123 1146 1.53e-1 SMART
ZnF_C2H2 1154 1177 1.56e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Zbtb40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zbtb40 APN 4 136987340 missense probably damaging 0.99
IGL00573:Zbtb40 APN 4 137018078 missense probably benign 0.00
IGL00774:Zbtb40 APN 4 136994524 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0334:Zbtb40 UTSW 4 136986556 missense probably damaging 1.00
R0393:Zbtb40 UTSW 4 137018531 missense probably benign 0.09
R0482:Zbtb40 UTSW 4 136983228 missense probably damaging 1.00
R1457:Zbtb40 UTSW 4 136984837 missense possibly damaging 0.81
R1846:Zbtb40 UTSW 4 137007839 missense probably benign 0.00
R2153:Zbtb40 UTSW 4 136991635 missense probably damaging 1.00
R2206:Zbtb40 UTSW 4 137017285 nonsense probably null
R2291:Zbtb40 UTSW 4 136985017 missense possibly damaging 0.78
R2406:Zbtb40 UTSW 4 136998568 missense probably benign 0.34
R3707:Zbtb40 UTSW 4 136999568 missense probably damaging 1.00
R4131:Zbtb40 UTSW 4 136995396 missense probably benign 0.00
R4243:Zbtb40 UTSW 4 137018549 missense probably benign 0.00
R4424:Zbtb40 UTSW 4 136998694 missense probably damaging 0.96
R4725:Zbtb40 UTSW 4 137018761 utr 5 prime probably benign
R4784:Zbtb40 UTSW 4 137007097 missense probably damaging 1.00
R4795:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4796:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4859:Zbtb40 UTSW 4 136988759 missense probably damaging 0.98
R4883:Zbtb40 UTSW 4 137000930 missense probably benign 0.09
R5001:Zbtb40 UTSW 4 136996150 missense probably damaging 1.00
R5030:Zbtb40 UTSW 4 136997952 missense probably benign 0.00
R5060:Zbtb40 UTSW 4 137001293 missense possibly damaging 0.71
R5529:Zbtb40 UTSW 4 136983163 missense possibly damaging 0.90
R5536:Zbtb40 UTSW 4 136987331 missense probably damaging 1.00
R5589:Zbtb40 UTSW 4 136995283 missense probably damaging 1.00
R6114:Zbtb40 UTSW 4 136988691 missense probably damaging 1.00
R6393:Zbtb40 UTSW 4 136984866 missense probably null
R7208:Zbtb40 UTSW 4 136999626 splice site probably null
R7406:Zbtb40 UTSW 4 137000894 missense probably benign 0.29
R7722:Zbtb40 UTSW 4 136991518 missense probably damaging 0.98
R7803:Zbtb40 UTSW 4 137017327 missense probably benign
R8292:Zbtb40 UTSW 4 136999567 missense probably damaging 1.00
R8735:Zbtb40 UTSW 4 136998646 missense probably damaging 1.00
R8890:Zbtb40 UTSW 4 136998586 missense probably damaging 1.00
RF014:Zbtb40 UTSW 4 137017306 missense probably benign 0.20
Z1176:Zbtb40 UTSW 4 136995463 missense probably damaging 1.00
Z1177:Zbtb40 UTSW 4 137018024 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGAGAAGAGTCCTCAGATTCC -3'
(R):5'- TTGCAGTAACTGGTGTCTGC -3'

Sequencing Primer
(F):5'- GATTCCAACTGATCTGCGACAGTG -3'
(R):5'- CCTGCAGGTGATTCAGAGCTG -3'
Posted On2016-03-01