Incidental Mutation 'R0422:Slitrk6'
ID 37151
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene Name SLIT and NTRK-like family, member 6
Synonyms 4832410J21Rik
MMRRC Submission 038624-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R0422 (G1)
Quality Score 195
Status Not validated
Chromosome 14
Chromosomal Location 110748580-110755149 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110749932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 781 (L781H)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
AlphaFold Q8C110
Predicted Effect probably damaging
Transcript: ENSMUST00000078386
AA Change: L781H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: L781H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Meta Mutation Damage Score 0.1203 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110751115 missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110751576 missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110750074 missense probably benign
IGL01295:Slitrk6 APN 14 110751436 missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110751624 missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110751817 missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110749794 missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110749941 missense probably benign
PIT1430001:Slitrk6 UTSW 14 110750427 missense possibly damaging 0.93
PIT4480001:Slitrk6 UTSW 14 110749825 frame shift probably null
R0035:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110751963 missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110752293 start gained probably benign
R0454:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0633:Slitrk6 UTSW 14 110751885 missense probably damaging 1.00
R0711:Slitrk6 UTSW 14 110749819 missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110750098 missense probably benign
R1298:Slitrk6 UTSW 14 110751865 missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110750928 missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110750552 missense probably benign
R1998:Slitrk6 UTSW 14 110751823 missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2140:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110751955 missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110750272 missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110751388 missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110750148 missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110750739 missense probably damaging 1.00
R4576:Slitrk6 UTSW 14 110750170 missense probably benign 0.05
R4856:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110750379 missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110749753 makesense probably null
R5281:Slitrk6 UTSW 14 110750373 missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110750097 missense probably benign
R5579:Slitrk6 UTSW 14 110751217 missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110752126 missense probably benign
R5935:Slitrk6 UTSW 14 110749873 missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110750526 missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110750247 missense probably benign 0.00
R6890:Slitrk6 UTSW 14 110751096 nonsense probably null
R6952:Slitrk6 UTSW 14 110750542 missense probably benign
R7378:Slitrk6 UTSW 14 110749863 missense probably damaging 1.00
R8354:Slitrk6 UTSW 14 110752046 missense probably damaging 1.00
R8401:Slitrk6 UTSW 14 110752021 missense possibly damaging 0.67
R8454:Slitrk6 UTSW 14 110752046 missense probably damaging 1.00
R8807:Slitrk6 UTSW 14 110750691 missense possibly damaging 0.77
R8814:Slitrk6 UTSW 14 110749938 missense probably benign
R8826:Slitrk6 UTSW 14 110751369 missense probably benign
R9681:Slitrk6 UTSW 14 110750826 missense probably damaging 1.00
R9740:Slitrk6 UTSW 14 110749998 missense probably damaging 0.99
R9740:Slitrk6 UTSW 14 110750012 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAATCCCAGCATTTCTGCAAAAGCC -3'
(R):5'- ACAACACATGGTGAGCCCAATGG -3'

Sequencing Primer
(F):5'- AAGCAGCCCCTCTATGTTTG -3'
(R):5'- AGCCCAATGGTTCATGTCTACAG -3'
Posted On 2013-05-09