Incidental Mutation 'R4838:Upf1'
ID 371545
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R4838 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 70792018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 402 (H402Q)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably benign
Transcript: ENSMUST00000075666
AA Change: H413Q

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: H413Q

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215817
AA Change: H402Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,944,523 (GRCm39) V386A probably benign Het
Adk G A 14: 21,419,154 (GRCm39) A247T probably damaging Het
Ankrd27 T A 7: 35,291,231 (GRCm39) L9Q possibly damaging Het
Atad2 A G 15: 57,966,679 (GRCm39) L638P probably damaging Het
Atf7ip T A 6: 136,573,489 (GRCm39) D1009E probably benign Het
Bend7 A T 2: 4,749,133 (GRCm39) K83N probably damaging Het
Bicc1 C T 10: 70,781,146 (GRCm39) D562N possibly damaging Het
Calcrl T A 2: 84,181,549 (GRCm39) N200Y probably damaging Het
Ccdc125 C A 13: 100,814,453 (GRCm39) A11E possibly damaging Het
Cd5l A G 3: 87,273,258 (GRCm39) T76A probably benign Het
Cdhr5 A T 7: 140,853,644 (GRCm39) I2N probably damaging Het
Cdk10 C T 8: 123,957,353 (GRCm39) A230V probably damaging Het
Cep128 T C 12: 90,966,319 (GRCm39) probably benign Het
Cep131 T C 11: 119,966,982 (GRCm39) N186D probably damaging Het
Cfhr4 T A 1: 139,661,181 (GRCm39) D556V probably damaging Het
Cog7 G T 7: 121,570,604 (GRCm39) P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 (GRCm39) M949L probably benign Het
Coq8b T A 7: 26,950,016 (GRCm39) M365K probably damaging Het
Cpa1 A G 6: 30,639,515 (GRCm39) E18G possibly damaging Het
Csmd2 A G 4: 128,411,542 (GRCm39) H2520R probably benign Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Dpm1 G A 2: 168,052,456 (GRCm39) T260I probably damaging Het
Dtx3 A T 10: 127,027,176 (GRCm39) probably null Het
Eepd1 T C 9: 25,500,756 (GRCm39) V401A possibly damaging Het
Ehhadh A G 16: 21,581,952 (GRCm39) S347P possibly damaging Het
Elp3 A G 14: 65,785,313 (GRCm39) probably null Het
Enam C T 5: 88,640,967 (GRCm39) Q210* probably null Het
Epha1 C T 6: 42,340,750 (GRCm39) R607H probably benign Het
Erich6 A G 3: 58,544,251 (GRCm39) I112T probably benign Het
F830045P16Rik A G 2: 129,302,470 (GRCm39) V374A possibly damaging Het
Fam171a2 C A 11: 102,329,511 (GRCm39) R416L possibly damaging Het
Fbn1 T C 2: 125,214,319 (GRCm39) N764S probably benign Het
Fip1l1 C T 5: 74,752,600 (GRCm39) T469I probably damaging Het
Flad1 G A 3: 89,313,217 (GRCm39) R342C probably damaging Het
Fzd3 A G 14: 65,477,269 (GRCm39) V95A probably benign Het
Garem1 T C 18: 21,280,950 (GRCm39) T469A probably benign Het
Gm17093 A G 14: 44,755,805 (GRCm39) Y24C unknown Het
Grap2 T C 15: 80,522,762 (GRCm39) V96A possibly damaging Het
Greb1 A T 12: 16,734,361 (GRCm39) probably null Het
Grid2ip A T 5: 143,374,530 (GRCm39) K913* probably null Het
Gzmk T C 13: 113,309,555 (GRCm39) D126G probably damaging Het
Hibch A G 1: 52,924,337 (GRCm39) I171V possibly damaging Het
Hipk2 G T 6: 38,795,339 (GRCm39) T310K possibly damaging Het
Hk3 T C 13: 55,154,231 (GRCm39) Y815C probably damaging Het
Hps5 A T 7: 46,437,778 (GRCm39) V99E probably damaging Het
Hspg2 A G 4: 137,268,977 (GRCm39) H2203R possibly damaging Het
Il12rb2 A G 6: 67,286,121 (GRCm39) V108A probably damaging Het
Il6st C T 13: 112,627,044 (GRCm39) R279* probably null Het
Kdm2a A C 19: 4,375,054 (GRCm39) S692R probably benign Het
Kif13a T C 13: 46,980,224 (GRCm39) K176R probably damaging Het
Kif5b T C 18: 6,216,869 (GRCm39) K485E probably damaging Het
Ktn1 C T 14: 47,963,413 (GRCm39) R1111* probably null Het
Lrrc23 A T 6: 124,755,152 (GRCm39) N128K probably benign Het
Mad1l1 G A 5: 140,286,017 (GRCm39) Q293* probably null Het
Man1b1 A T 2: 25,235,487 (GRCm39) I338F possibly damaging Het
Marchf1 G T 8: 66,921,015 (GRCm39) V225L probably damaging Het
Matcap2 A T 9: 22,335,673 (GRCm39) D97V probably damaging Het
Mrpl3 A G 9: 104,934,231 (GRCm39) D118G probably damaging Het
Nomo1 A T 7: 45,733,139 (GRCm39) Q1209L unknown Het
Nrcam A G 12: 44,620,802 (GRCm39) E949G probably damaging Het
Olfm5 T G 7: 103,803,572 (GRCm39) N297T probably damaging Het
Or51h7 T A 7: 102,591,453 (GRCm39) L110F probably damaging Het
Pcdh7 A T 5: 57,878,146 (GRCm39) N567I probably damaging Het
Pkn1 A G 8: 84,404,595 (GRCm39) L495P probably damaging Het
Pkp1 T C 1: 135,810,326 (GRCm39) S415G probably damaging Het
Pou2f1 T A 1: 165,744,492 (GRCm39) Q53L probably null Het
Pramel26 G A 4: 143,537,375 (GRCm39) Q319* probably null Het
Prkce A G 17: 86,937,511 (GRCm39) K648R probably benign Het
Ptprh G A 7: 4,576,429 (GRCm39) T277I possibly damaging Het
Rpl31 C T 1: 39,410,048 (GRCm39) R83C probably benign Het
Rpusd3 G A 6: 113,393,837 (GRCm39) Q194* probably null Het
Sgsm1 T A 5: 113,430,492 (GRCm39) N298Y probably damaging Het
She G A 3: 89,758,946 (GRCm39) G355D probably benign Het
Shld2 A G 14: 33,990,582 (GRCm39) V108A probably benign Het
Snx11 C T 11: 96,665,284 (GRCm39) E9K possibly damaging Het
Soat1 C A 1: 156,260,507 (GRCm39) A444S probably benign Het
Sox6 T C 7: 115,085,897 (GRCm39) Y690C probably damaging Het
Spata13 T A 14: 60,970,628 (GRCm39) F10I probably benign Het
St18 C A 1: 6,873,129 (GRCm39) T288K probably benign Het
Tifa C T 3: 127,590,235 (GRCm39) S2F probably damaging Het
Tmem232 A T 17: 65,737,883 (GRCm39) S392R probably benign Het
Tmtc3 T C 10: 100,302,082 (GRCm39) N289S probably damaging Het
Tpo A G 12: 30,142,633 (GRCm39) F697S probably damaging Het
Trp53 A G 11: 69,478,456 (GRCm39) T122A probably damaging Het
Trps1 A C 15: 50,690,712 (GRCm39) I10S probably benign Het
Tubgcp5 C T 7: 55,443,933 (GRCm39) probably benign Het
Unc13c T G 9: 73,839,354 (GRCm39) Y499S possibly damaging Het
Unc45a C A 7: 79,982,783 (GRCm39) D381Y probably damaging Het
Uroc1 A T 6: 90,326,174 (GRCm39) I510F possibly damaging Het
Usp15 A G 10: 122,963,662 (GRCm39) F589L probably damaging Het
Vmn2r76 T C 7: 85,874,733 (GRCm39) Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 (GRCm39) N151D probably benign Het
Zbtb40 A T 4: 136,728,527 (GRCm39) S439T probably benign Het
Zbtb6 A T 2: 37,318,728 (GRCm39) L400* probably null Het
Zfp125 C T 12: 20,949,961 (GRCm39) noncoding transcript Het
Zmynd8 A C 2: 165,681,954 (GRCm39) Y183* probably null Het
Zpld2 A G 4: 133,920,410 (GRCm39) V585A probably benign Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2143:Upf1 UTSW 8 70,792,004 (GRCm39) missense probably null 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7205:Upf1 UTSW 8 70,792,695 (GRCm39) missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70,793,268 (GRCm39) missense probably damaging 1.00
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8079:Upf1 UTSW 8 70,791,534 (GRCm39) critical splice donor site probably null
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8544:Upf1 UTSW 8 70,789,702 (GRCm39) missense probably damaging 1.00
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70,786,815 (GRCm39) nonsense probably null
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCAGCAGCTTGTGGTAAATATAC -3'
(R):5'- GTGAGTGAAACAGCCTGGAGTC -3'

Sequencing Primer
(F):5'- TATACCCTGACACAGAGGTCTCGTC -3'
(R):5'- AAACAGCCTGGAGTCTGTCTG -3'
Posted On 2016-03-01