Incidental Mutation 'R0422:Efna5'
ID37160
Institutional Source Beutler Lab
Gene Symbol Efna5
Ensembl Gene ENSMUSG00000048915
Gene Nameephrin A5
SynonymsEFL-5, Epl7, RAGS, AL-1, LERK-7, Ephrin-A5
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0422 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location62604184-62881317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62607419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 177 (A177T)
Ref Sequence ENSEMBL: ENSMUSP00000077883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076840] [ENSMUST00000078839]
Predicted Effect probably benign
Transcript: ENSMUST00000076840
AA Change: A204T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000076115
Gene: ENSMUSG00000048915
AA Change: A204T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 29 158 4.5e-42 PFAM
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078839
AA Change: A177T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077883
Gene: ENSMUSG00000048915
AA Change: A177T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 26 164 2.4e-58 PFAM
low complexity region 187 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin-A5, a member of the ephrin gene family, prevents axon bundling in cocultures of cortical neurons with astrocytes, a model of late stage nervous system development and differentiation. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormalities in establishing correct axonal connections involving the retinal, motor, vomeronasal, and tactile axons to their respective targets. Some mutants develop neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Efna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Efna5 APN 17 62613379 missense possibly damaging 0.73
IGL02142:Efna5 APN 17 62607345 missense unknown
IGL02152:Efna5 APN 17 62651060 missense probably benign
IGL02534:Efna5 APN 17 62613389 nonsense probably null
IGL02556:Efna5 APN 17 62651028 missense probably damaging 0.99
R0041:Efna5 UTSW 17 62607472 splice site probably benign
R0265:Efna5 UTSW 17 62651073 missense probably damaging 1.00
R0565:Efna5 UTSW 17 62881036 missense probably damaging 1.00
R2039:Efna5 UTSW 17 62881066 missense probably benign 0.00
R2570:Efna5 UTSW 17 62881028 missense probably benign 0.04
R4621:Efna5 UTSW 17 62651045 missense probably benign 0.00
R4622:Efna5 UTSW 17 62651045 missense probably benign 0.00
R5672:Efna5 UTSW 17 62881030 missense probably damaging 1.00
R5723:Efna5 UTSW 17 62607463 missense probably damaging 1.00
R7876:Efna5 UTSW 17 62650934 missense possibly damaging 0.74
R7959:Efna5 UTSW 17 62650934 missense possibly damaging 0.74
R8049:Efna5 UTSW 17 62650982 missense probably benign 0.39
RF007:Efna5 UTSW 17 62613394 missense probably benign 0.00
X0021:Efna5 UTSW 17 62607400 missense probably damaging 0.98
X0025:Efna5 UTSW 17 62651037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCTGTCACTCTGACAATCTG -3'
(R):5'- AGGAAGTCCAATTTCCCCTGCCTC -3'

Sequencing Primer
(F):5'- ACAACCCCAAGTTGTTGCTTAG -3'
(R):5'- TTATGCAGACATGAAAGTCAATGGTG -3'
Posted On2013-05-09