Mutagenetix > Incidental Mutations

Incidental Mutation 'R4839:Mertk'

371605

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R4839 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128782576 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 636 (M636V)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: M636V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: M636V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157160

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 9,008,013	S467T	probably benign	Het
2310030G06Rik	A	T	9: 50,740,723	Y68*	probably null	Het
4931408C20Rik	T	C	1: 26,685,359	T247A	probably benign	Het
9130019O22Rik	T	C	7: 127,385,007	S308G	probably benign	Het
Abat	T	G	16: 8,583,648		probably benign	Het
Abca2	C	T	2: 25,440,909	S1203F	probably damaging	Het
Adam22	G	A	5: 8,136,813	P436L	probably damaging	Het
Ak3	A	C	19: 29,047,732	L33R	probably damaging	Het
Arhgap11a	A	T	2: 113,842,029	I198K	probably damaging	Het
Arl14epl	A	T	18: 46,932,477	K103M	possibly damaging	Het
Atg16l1	T	A	1: 87,766,174	N65K	probably damaging	Het
Btnl2	G	A	17: 34,365,286	W394*	probably null	Het
Cacna1e	C	A	1: 154,421,058	R1687L	probably damaging	Het
Cacna1g	G	T	11: 94,459,607	R471S	probably benign	Het
Cdh13	A	T	8: 118,851,848	R205*	probably null	Het
Cdkl3	A	T	11: 52,005,034	Y36F	probably damaging	Het
Cep290	T	A	10: 100,508,786	N488K	probably damaging	Het
Cep350	A	T	1: 155,928,494	C948S	probably benign	Het
Cep70	A	G	9: 99,296,085	K446R	probably benign	Het
Cfap70	T	C	14: 20,425,529	T375A	probably damaging	Het
Cfhr1	A	G	1: 139,560,133	L9S	probably damaging	Het
Chrm4	T	A	2: 91,927,607	M120K	probably damaging	Het
Col1a1	A	G	11: 94,950,095		probably null	Het
Col3a1	T	C	1: 45,323,803		probably null	Het
Csrnp3	A	T	2: 66,022,031	R256*	probably null	Het
Dbf4	T	A	5: 8,408,263	K190*	probably null	Het
Dnah10	A	T	5: 124,773,132	I1573F	probably damaging	Het
Dock8	A	G	19: 25,169,494	I1446V	probably benign	Het
Dst	G	T	1: 34,190,862	R2187M	probably damaging	Het
Ece2	C	T	16: 20,631,168	R257C	probably damaging	Het
Espn	A	G	4: 152,138,504	Y306H	probably damaging	Het
Fam208b	G	A	13: 3,584,807	P667S	probably damaging	Het
Fkbpl	G	A	17: 34,645,865	M202I	probably benign	Het
Fn1	A	G	1: 71,642,083	L362P	probably damaging	Het
Ganc	A	C	2: 120,459,823	R880S	probably benign	Het
Gucy1b2	A	T	14: 62,448,246	L90Q	probably damaging	Het
Hcn1	T	A	13: 117,925,710	I504N	unknown	Het
Hdac2	C	A	10: 36,997,466	T352K	probably benign	Het
Hip1	T	C	5: 135,426,318		probably null	Het
Hspa13	G	A	16: 75,765,281	S10L	probably damaging	Het
Ipo5	T	C	14: 120,920,038	I96T	probably benign	Het
Isl1	T	C	13: 116,301,684	Y264C	probably damaging	Het
Izumo1	T	C	7: 45,626,233	I322T	probably benign	Het
Kars	A	C	8: 112,002,526	V183G	possibly damaging	Het
Lrrc15	C	A	16: 30,274,268	M84I	probably benign	Het
Magi1	A	T	6: 93,694,196	V796E	probably damaging	Het
Matn4	G	T	2: 164,400,976	D67E	probably benign	Het
Mettl27	C	A	5: 134,934,412	P126T	probably damaging	Het
Mfrp	T	A	9: 44,102,135	H52Q	possibly damaging	Het
Mrgprb8	T	G	7: 48,388,908	I109R	probably benign	Het
Mroh2a	G	A	1: 88,237,944	G512S	probably damaging	Het
Ncoa7	T	A	10: 30,722,659	R89S	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Nin	G	T	12: 70,090,551	H84N	possibly damaging	Het
Nwd2	A	T	5: 63,805,550	I826F	possibly damaging	Het
Olfr195	A	G	16: 59,149,030	Y60C	probably damaging	Het
Olfr299	T	C	7: 86,465,909	F166S	probably damaging	Het
Olfr339	G	A	2: 36,422,000	V201I	probably benign	Het
Olfr498	T	C	7: 108,465,731	S136P	probably benign	Het
Olfr69	T	C	7: 103,767,754	I214M	possibly damaging	Het
Olfr724	C	T	14: 49,960,189	M294I	probably benign	Het
Olfr959	A	G	9: 39,573,145	M38T	probably benign	Het
Otof	C	T	5: 30,419,404	R168H	probably damaging	Het
Pcdha6	T	C	18: 36,968,432	V226A	possibly damaging	Het
Pggt1b	T	C	18: 46,258,099	I200V	possibly damaging	Het
Ppat	G	A	5: 76,950,964	Q41*	probably null	Het
Ppfibp2	A	T	7: 107,742,985	H27L	probably damaging	Het
Rbm27	T	A	18: 42,327,445	I775N	probably damaging	Het
Rnf40	C	T	7: 127,592,640	R349*	probably null	Het
Rtp3	A	T	9: 110,989,476	W46R	probably damaging	Het
Sass6	C	T	3: 116,610,300	R196W	probably damaging	Het
Sel1l	A	T	12: 91,833,158	D131E	probably benign	Het
Slain2	T	C	5: 72,948,723	S234P	probably damaging	Het
Slc47a1	C	T	11: 61,373,350		probably null	Het
Sp140	CAGAAGAAG	CAGAAG	1: 85,610,808		probably benign	Het
Spef2	A	T	15: 9,713,178	Y369*	probably null	Het
Spred2	T	A	11: 19,998,233	M76K	possibly damaging	Het
Svs2	T	A	2: 164,236,886	D367V	probably benign	Het
Tefm	A	T	11: 80,137,121	D270E	probably benign	Het
Tfcp2l1	C	A	1: 118,669,464	P425H	probably benign	Het
Thbd	A	T	2: 148,406,671	C426S	probably damaging	Het
Timm10b	T	A	7: 105,684,012	D968E	probably damaging	Het
Tle2	C	T	10: 81,577,684	T119I	probably damaging	Het
Tnik	T	A	3: 28,596,075	Y446N	possibly damaging	Het
Tpr	T	A	1: 150,449,197	L2400*	probably null	Het
Trrap	T	C	5: 144,845,592	F3328S	probably damaging	Het
Vldlr	G	A	19: 27,238,065	C154Y	probably damaging	Het
Vmn1r79	T	G	7: 12,176,434	M81R	probably benign	Het
Vps13d	T	C	4: 145,085,430	T3305A	possibly damaging	Het
Wdr62	T	C	7: 30,270,686	E232G	probably damaging	Het
Wdr62	T	A	7: 30,241,465	I843F	probably benign	Het
Zfp873	T	A	10: 82,060,519	H361Q	probably damaging	Het
Zfp949	A	C	9: 88,569,994	H539P	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGTGCTGTTCCTGGTCC -3'
(R):5'- GGTTAACTCCATCAGCACCC -3'

Sequencing Primer
(F):5'- TGGTCCCCACCCCTGAG -3'
(R):5'- GGTTTTACTCTCAGCCTCAGAAAG -3'

Posted On

2016-03-01